Gene detail

Detailed information of OS493_003736-T1 in Lophelia pertusa

Genomic Location: scaffold_7:5395345...5424915
NR annotation: KAJ7394063.1, hypothetical protein OS493_003736 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003736-T1

ATGAGTAACAAGCTTTCTAGCAAGCCATCCAAGAAGGATCGTCCGAGATCCACAGATGAATTATGCACAGGACCGTCAGTTGGAAAAGTTATCAGTGGTGATGACATTGATTCCCTGGCAATCAACGTGGATGAGCTAAAAAAGGTGCATCCCCCTAAGAGGCCATCTGTCCCTAAGCCATCATCAACCATAATGGTGCGCAAGGCTCGGCTCAAGCAATCATTGGAGCAGAACCAACCAGTAGGAAAGAGTGTGACTGTTGCACGACCAGCTCCTCCAGACGCTCCTTTAGTATCAACTCCACTTGTTGGTTCAACTGGTCCTCAGTTTGATGAAGATGGACAAGTGTTGACTTATACAATGTTAGGCTCATGGGAAGATTTTCAACAGGAAGCTATCAATAGGGGGGACATTGAGAATCTACCTCCATTCTCTGCTTACAAGTTTGGTGCTGGTAAAGTTAGGCCAACAACTAAAGGCACAAAAAAGGAAAAGAAGTTTTCCAGTCATGTTTGGCAAACAAGGAGACAGATGATGCAAAGAAAGAACAACAACAACCACCTGTCCAATATGCTGAACACTTCAACGGACATGTTGGTAATGAACCAAAGTGAGGATTACAGAGGAACACAAGAGGACAGGTATGCTATTGACAGGTCAATCCCATCAATGGACTATGGGAAAGGATATCGTGTTGGCAGTGAGTTCTGGAAACAAGTGGAACAAATAGGAGATGATGAAACAGGGGTCAAACTGAGCGTGGTTATCCGCCAGCAATTGAAACACATTGGAAAAGCCATCTATATCAAGAATGAAATGGGCATAGAATGGGCCAATACTCACAGGTCAGCATCAGTGCACTATCCATGGCAGAAGTCAACATACCTTCAGGACAGAACAAAACAGCTTCAAACTGTTCTACATGAGTTGGACCCACACCAGCCATACATTGACGAGCTTGAGGTGATTGGCTCAAACCAGCCTCAGCATTCATCCAAGTTTGACATGATGTCCATAGTACAGGAGGAGGAGGAGAGTGAAATACTGGATGAATCCATGAGTGAAAGGGACCCTCTGGCAAACATTGCTGACGTTGTACCTCAGCCCATATTTGGACCGTCGTTATCCATTGGTGGCCACACGGCCCAGTGGAATGGATCGAGAGCAGGTGTCAATGGACAAGTGGGCGTGTCCTGCCGCGTGATATTTGAGGCCAATGTAGGAGATAGGATCACTTCTCATTTGAATATATGCAATGATGGAACAACTGCCATCTACTTCTCTTGGAAGAAAATACCACGGCCAAATGTACTGGGTACAAAGCTTGCAGGACAGACTCAAAGGTTTTACTTTGACACCAAGAGCGGGGTGATTCTACCGGGGGATACGTTGAAGTTCCCATTCATATTCAAATCCCCCAATGCCGGGATCTTCACAGAGACGTGGGAACTGATGACAAAGCCTACATTGTGTGGTGGTGCTCCTATAAGAGTCACTCTGAGAGGTGTAGCAGTAGAGGATGACATTTACAAGGAAGCCAGGCAACAAATTGAACAGGAACTGGCTCACAGGGAGGCAGTGGAGACTGCATCAAGGCTTCTTGATGAAATCCTTGAAGGCGTCCGTACACCTGAACGAGCCAGATCCCCGGTGGACGCTTATATCACGGAGGAAGAGATCTTTGGAAGAGCTAATCAAGGGATGCATTTCCAAGATGAGGTTGTTCAAGAACTGAAGCAGATTTACGCGCAGCTCGAAGAAGAGGAGGACTGGGACTTATCGCTACAGTCACTTCAACAGGTAACCCAGCACATTGCACTGGTCCGAATAAACTCCTCATCAAATTACTCCACAGGTAACCCAGCACATTGCACAGGATCAAAATCATGTCAGTTTGAAGATGCAGATCAGCGCGATAGTCTGCTTCAGACGCTGAACACGTCTATATCAACCTTGTCATTCCCGCCAATGACTCCTGTAAAACACGCCATGTACGCTGCAGGTTATCAACTGCTGTGTGAGATGGTGGACAGTATTGTGGGTCAGGCCAACATGATACGATCTATTTCTTGGTTCTTCCTGAGAGAGAGCTTGTCGAGGATACGTCACAAGAGGAAGTCTTCAAGTGAAGACGTTTTCGCTGAGATGGAGGTTGTGACAAAGGAGCTACTTGAGAAACGACTGCGTAAAGGAACAACTTCTGAAACGAAAGCAGACAGCAAGAAGGGAGACAAGAAAGACAAGAGAGGAGCCAAGCTTTCTGAAACTGATCGCCCAAATTCCACTCAACGGTCCAAGTTATCAGCGAAAAAGTCTGGAAGAGGTACCAGTACACCTTCTTCGCAGTCTAAATCAGCCCTCAGTGAGACGGCAGCGGAGAGGACTGGGACTCCGGCCAGTGTGGACGGCTTAACAGTGGAGAATGCTGCTGACCCTGTTTTAGAAGCAAAATACAGAGAGAAGCTATTTACACAGGCTTATGCCCTTGTGGTGGATGCGTTTGACAGAATGGACATGGTTTTTGATGACATTAAAAACTGCGGAATTGAAGTTGTCGCAGTAAAACATGTGTTGCTTAGCTACCGGGAACAAACTAATTATGATGTGACATATTTATATCAAGTCTTGTTATTGTAG

Transcript

OS493_003736-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5SUV2	MYCBP-associated protein OS=Mus musculus OX=10090 GN=Mycbpap PE=1 SV=1
Q69CM7	MYCBP-associated protein OS=Rattus norvegicus OX=10116 GN=Mycbpap PE=1 SV=1
Q8TBZ2	MYCBP-associated protein OS=Homo sapiens OX=9606 GN=MYCBPAP PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003529 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14646 all species →	MYCBPAP	MYCBP-associated protein family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032707 all species →	Family	MYCBP-associated protein	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR052822 all species →	Family	MYCBP-associated	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48333 all species →	MYCBP-ASSOCIATED PROTEIN	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_003736-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25648	MYCBPAP, AMAP1; MYCBP-associated protein	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003736-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

36.4Max TPM

11.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.48	19.11
polyp at pH7 6	18	18	9.94	15.35
coral polyp · control treatment	16	16	15.51	36.38
coral polyp · oil and dispersant treatment	16	16	10.30	32.10
coral polyp · oil treatment	16	16	13.41	23.52
coral polyp · dispersant treatment	16	16	9.73	22.43
Polyp	10	10	14.08	17.70

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.11
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.42
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.17
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.62
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.80
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.62
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.21
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.88
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.83
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.58
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.24
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.82
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.70
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.51
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.51
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.35
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.32
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.39
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.99
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.93
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.71
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.11
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.01
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.86
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.57
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.86
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.36
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.23
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.11
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.38
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.38
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.01
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.44
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.23
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.10
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.18
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.16
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.25
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.87
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.13
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.20
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.04
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.60
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.10
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.25
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.15
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.87
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.02
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.11
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.97
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.12
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.79
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.69
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.97
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.74
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.47
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.52
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.43
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.23
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.18
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.89
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.82
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.23
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.13
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.12
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.85
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.87
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.91
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.26
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.86
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.55
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.15
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.96
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.50
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.30
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.02
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.70
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.52
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.50
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.46
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	16.48
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.23
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.04
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	14.92
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	13.72
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.46
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.35
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.58
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.