Gene detail

Detailed information of OS493_003754-T1 in Lophelia pertusa

Genomic Location: scaffold_7:5588705...5596740
NR annotation: KAJ7394079.1, hypothetical protein OS493_003754 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003754-T1

ATGGAGAATTTGAGGAAGGACCAAAATTCACCAAAAATGTTACAAATGATTCGCGTTAGAAGCTTACTTAGCAACGTTTTCAACAAATATGTGTCCAAGGAATGGATTGAGAGTGATCTCTTCTTTTTAACCAATCAAACATTGGCTAATAAAAGCTGCTCAGACTGGATACAATTCCAAGCAAATAATCTTTCTCTTGTGGAAGATTATAAGCGCTTAACGCCTTGTCCAAAGACTCAAAGGCAGATGAAGGCGGATATGGGACGTTTTACGGTTTGCGAGTTGTGTGGTACAGAGACTATGCCTCTATGTAAAATATATTACAAGAAGGTGGATATTTGTTACAGAACAAGAACTATAAGTGCACGAGAACTAGAACGAAAATGTTGCTATGACAACAAAGGAGAGTTAACTCCAGGTCCAGTCAGTGGCATCACCAATCATGAATATTCTGGCGCAGACGCATCGATATTCTCACTCTTTTGGGAGGACGTGGTGCCTTACCTAGAATGCTGCATGTTTTCAAACAACTGCTTCAAGTACCAAGATCTGGGAGCGTCTGCATCGCGATATATTCCTCCAAACATTGGAGCGTCATTTGGTGATCCTCATATCATTACCTTTGATAGTGTGGAATACACGTTCAATGGATTTGGCGAGTACACAGTTCTTAACGTCAATAACTCGCAGTTCATTCTTCAAGGAAGAATGCAGCCTTTGAATGGTGGACACAACGGAAAATCTCCGGCTACAGTATTTACCGCATTTGCGATGAAGCAACAGGGCGGCAGCTCGATTCAAGTACAACGGAATGATCTTCAATCAATAAACGTTTGTATAGACGGAATACCAAGTGTTATCGATTATGGCCACGAACAGCAAGCAACAGGAGTGTTTATAAGAAACAGCTCGCGAGAAAATAACCCAAGAGTCATACTTGCCTTTAACTCTGGCATCACCGTGTATGTAGAAAATGCTGCAGTTCTGCAGATGGCAGTAGCTGTTCCCGTCGAGTTTAAAGGAAAAACAAGCGGACTCCTTGGATATTGGGATGATAATAGTGACAAGGAGTATCTTCTACCCAACAACAAATATCTCAACACAGCGTCCACCATGTCCGAAATACATCACACGTTTGGTCAGCAATGGGCCACAAAAGAAAGCGATTCGCTGTTCACCTACGGCCCAGGAGAAAATCACGAGGATTATTTCGACACTTCCTATGTTCCAACCTTCATGGAGGGCTATGATCCTATCATCGCCAAGATGAGCAGTGATGCGAGAAAGAGAGCGCTTGTGACTTGCGAGCAATCATTTCAGTGCATATTTGACATCGCAGTGACAGGACGATTGGATGTTGGCAAGGCTACCAAGGAGTTCCAGGAATGGTTAATGGGCATAAAAAGGAACCTCCACGACGAAGGATGCAGCGTAGTTTTAAGCCTTGTCGGAGGATCGGTACGAACGAACGTCACAGGTGACCTCGTGACACACTATTTTACATGTAACCATGGTTACGTAATGGCTGGCAAGGATAGAATTTCTTGCAGCGGAGGATTCTGGGATGGATCAAAACCTACCTGCTATAGAGGGTCTGGAGTCTGTAAGCAATTGCATATTTCGTTTCCCAACGGTAACTTCCATGGTCAAGGAAAGAAGCTTGGTGATCGATACAGATTTAAGTGCGACTTTCCATTCAAACTCATTGGGAATGAAGAAATTGTCTGCGGAAAAGATGGATTATGGAACGGAAAAGTGCCCTTTTGCCAAGGAACAAACTGCTCTCAAGTGAATATAAATAATTCTCAAGTGCTAATTGGAAGTGAAGGTCAGCTCGTCATCAGCTGTAATGAGGGATACACTCTGATTGGATCCAGTGTAATAAACTGCTTGAATAACGGATTATTGAATGGCACGTTACCCTCGTGCGTCAGAGAACAGTTCCTGACAGCCTCTGCAGATAACAGAAGCATCCTCCTTGTCATCGTGGTCGGAGTGGTAGTTATTATCATCATAATTATTGTGGTTGCGGTGACAACTTACCTGGTGCGTAAACATCACAGGCGGAAATCTACTCAAGCACGAAAGAAGACACCGAAGTCAACAAAGTCACAAGATGAGGTATCAGTCTGA

Transcript

OS493_003754-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UGT4	Sushi domain-containing protein 2 OS=Homo sapiens OX=9606 GN=SUSD2 PE=1 SV=1
B3EWY9	Mucin-like protein (Fragment) OS=Acropora millepora OX=45264 PE=1 SV=1
H9JIQ1	Protein mesh OS=Bombyx mori OX=7091 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000637 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00084 all species →	Sushi	Sushi repeat (SCR repeat)	Domain	Interproscan
PF03782 all species →	AMOP	AMOP domain	Domain	Interproscan
PF00094 all species →	VWD	von Willebrand factor type D domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000436 all species →	Domain	Sushi/SCR/CCP domain	Interproscan
IPR035976 all species →	Homologous_superfamily	Sushi/SCR/CCP superfamily	Interproscan
IPR005533 all species →	Domain	AMOP domain	Interproscan
IPR001846 all species →	Domain	von Willebrand factor, type D domain	Interproscan
IPR051495 all species →	Family	Epithelial Barrier and Cell Signaling Protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13802 all species →	MUCIN 4-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23820	SUSD2; sushi domain-containing protein 2	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003754-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

104TPM > 0

7Conditions

9.3Max TPM

2.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	1.68	3.42
polyp at pH7 6	18	15	1.45	2.56
coral polyp · control treatment	16	16	3.74	7.18
coral polyp · oil and dispersant treatment	16	16	4.47	7.61
coral polyp · oil treatment	16	16	2.92	5.27
coral polyp · dispersant treatment	16	15	2.99	9.34
Polyp	10	9	3.11	8.50

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.42
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.09
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.74
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.54
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.19
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.66
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.66
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.56
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.54
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.27
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.96
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.90
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.86
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.74
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.56
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.32
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.26
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.02
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.93
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.92
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.84
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.76
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.48
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.45
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.44
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.13
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.93
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.18
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.45
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.41
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.31
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.05
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.25
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.91
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.68
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.22
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.18
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.62
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.36
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.14
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.39
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.44
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.36
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.55
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.70
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.46
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.17
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.86
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.81
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.20
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.13
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.05
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.84
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.98
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.72
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.27
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.20
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.77
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.37
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.32
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.14
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.36
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.01
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.53
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.47
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.61
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.44
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.29
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.22
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.21
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.53
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.34
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.37
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.10
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.50
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.18
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.08
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.99
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.94
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.94
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.60
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.40
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.89
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.11
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.92
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.55
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.50
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.89
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.42
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.45
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.36
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.76
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.23
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.80
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.66
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.