Gene detail

Detailed information of OS493_003823-T1 in Lophelia pertusa

Genomic Location: scaffold_7:6233542...6251102
NR annotation: KAJ7394145.1, Aconitate hydratase mitochondrial [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003823-T1

ATGGCGGCCGCAAAGAGCCAGTACACCTCTCATATCAAGAACCTTTCCCTGAACTGTGGAGAATACAGTTACTTCGACGTATCCAGCTTAAACGGAGAAAGATACGAACGCCTACCGTTTTCAATCAGGGTACTGTTGGAGTCTGCAGTTCGTAACTGTGATGGCTTTCAAGTGACGTCCAAGGATGTAGAAAATATATTGGACTGGGAGAATAACCAGAAGCAAAATGTTGAAATCCCCTTTATGCCAGCAAGAGTTATCCTCCAAGATTTTACTGGGGTTCCTGCGGTGGTTGACTTCGCTGCTATGCGGGATGCTGTTAAAAGACTTGGAGGAGATCCGGGCCATATCAACCCACTGTGTCCTGTAGATCTCGTCATCGATCATTCAGTGCAAGTGGATGTATCACGAAGCTCTACTGCACTTCAGAAGAACCAGGAAATGGAGTTTATGAGAAACAAGGAGAGGTTTCTTTTTCTGAAGTGGGGCTCAAAAGCATTCAAGAATATGACAATTGTCCCACCTGGCTCAGGCATAGTTCACCAGGTTAATCTCGAGTATCTTGGCCGAGTTGTTTTTAACATTGACAAAGTTATGTACCCGGACAGTGTTGTTGGAACAGACTCGCACACAACTATGATTAATGGACTTGGGATTGTCGGATGGGGTGTTGGAGGTATTGAAGCTGAAGCAGTCATGTTAGGGCAGGCCATCAGTATGGTGTTACCTAAAGTTGTTGGGTATAAGCTGACTGGGCATGTGAATCCATTTATCACATCCACTGATGTTGTGCTCACGATTACAAAGCACCTTCGCCAAACTGGTGTCGTGGGTAAATTTGTGGAGTTCTTTGGACCTGGTGTTGCTCATCTGTCCATTGCAGACAGAGCTACCATCGCTAACATGTGCCCAGAGTATGGTGCGACTGTAGGTTACTTTCCTGTTGATGAGAAGAGTTTATTGTACCTCAGACAGACAGGTCGCAGTGACGAGACTCTTGAACGTGTCGAAGCCTACATGAAAGCTACAAAAATGTTCCGGGACTTCTCAGACCCAAGCAATGATCCAGTGTTCTCAGAGATTGTAGAGCTGGACTTGTCCACTGTAACTCCATCATTATCGGGGCCCAAGAGACCTCATGACAGGGTTGCTGTGTCTGATATGAAGCAGGACTTCTCAGACTGTTTAAACAATAAAATTGGATTTAAAGGTTTTGGTATCCCACCTGAAAAACAGAATATAGAGGTTCCTTTTACTTATGATGGCCAGGAGTTCAAGTTATCACATGGTTCTGTAGTGATAGCTGCCATCACAAGTTGCACAAACACAAGTAATCCATCAGTTATGCTTGGAGCAGGACTGTTAGCTAAGAAAGCCGTCGAACTGGGCCTGGATGTGAAACCATACATTAAAACAAGTTTATCGCCAGGCTCAGGAGTGGTTACATACTATCTTCAGGAGAGTGGAGTGACACCAAGTCTGGAAAAGCTAGGGTTTAACGTGGTAGGCTATGGTTGTATGACATGTATTGGCAACTCTGGTCCTTTATCTGAACCAGTATCAGAGGCGATAGAAAAGGGTGACCTTGTTGCTGTGGGTGTGTTATCAGGAAACAGAAATTTTGAGGGACGCATCCATCCCCTGACGAGAGCAAACTACCTTGCGTCCCCTCCCCTAGTGATTGCTTATGCCATTGCCGGCACTGTGCTCATAGACTTTGAGAAGGAGCCCTTAGGTATTTCCAAAGATGGAAAAAAAGTTTTCCTCAGGGACATCTGGCCATCAAGGGAAGAAATTCAGGAGGTCGAGAGGAAGTTTGTTATTCCTGCCATGTTCAAAGAAGTCTATGCTAAAGTAACGACTGGCAATCCTCGCTGGAACTCACTTGAGGCACCAGACAGTCTGCTGTACCCATGGGATGAAAAATCAACGTACATCAAGCATCCACCTTTCTTTGCTACAATGGCCAATGATTTGCCGACGCGTGACAGCATTACAGATGCCGCTGTACTGTTGAACTTGGGAGACTCTGTTACCACTGACCACATATCTCCTGCAGGAAGCATTTCTCGCACCAGTCCCGCCGCTCGTTATCTGGCTGGAAGAGGGCTTGTACCTCGTGACTTCAATTCTTATGGTTCTCGCCGCGGAAATGATGCTGTAATGGCGCGTGGAACATTTGCTAACATCAGACTGGTGAACAAATTCATTGGAAAAGCTGCGCCTAAAACCATTCATGTTCCTTCTGGAGATACGATGGATGTTTTTGATGCAGCTGAACGTTACCGCCAAGAGGGACGACAGCTCATTATCCTGGCCGGAAAGGATTATGGGTCAGGATCGTCACGTGACTGGGCGGCAAAGGGACCTTGGATGCAGGGCGTCAAGGCGGTGATATCGGAGAGTTTTGAGCGAATTCACCGAAGCAATTTGGTAGGAATGGGTATCATGCCCCTTGAATATCTTCCCGGTGAGACCTCGGAGAGCCTGGAACTCACCGGAAAAGAAAACTACACCATTGAAGTACCGGAAGACCTGAAAACTGGCCAAACACTGGATGTGAAGTTGAATGATGGCCGCACCTTCAAAGCGAAAGTTCGTTTTGACACAGACGTGGAATTGATGTACTTCAAACATGGAGGCATCCTGAACTACATGATAAGGAGCATGCTCAGTAAAGAAGACTGCTGA

Transcript

OS493_003823-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P28271	Cytoplasmic aconitate hydratase OS=Mus musculus OX=10090 GN=Aco1 PE=1 SV=3
P21399	Cytoplasmic aconitate hydratase OS=Homo sapiens OX=9606 GN=ACO1 PE=1 SV=3
Q01059	Cytoplasmic aconitate hydratase OS=Oryctolagus cuniculus OX=9986 GN=ACO1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002405 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00694 all species →	Aconitase_C	Aconitase C-terminal domain	Domain	Interproscan
PF00330 all species →	Aconitase	Aconitase family (aconitate hydratase)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018136 all species →	Binding_site	Aconitase family, 4Fe-4S cluster binding site	Interproscan
IPR006249 all species →	Family	Aconitase/Iron-responsive element-binding protein 2	Interproscan
IPR015931 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3	Interproscan
IPR036008 all species →	Homologous_superfamily	Aconitase, iron-sulfur domain	Interproscan
IPR044137 all species →	Domain	Aconitase A, swivel domain	Interproscan
IPR001030 all species →	Domain	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha domain	Interproscan
IPR000573 all species →	Domain	Aconitase A/isopropylmalate dehydratase small subunit, swivel domain	Interproscan
IPR015928 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase, swivel	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11670 all species →	ACONITASE/IRON-RESPONSIVE ELEMENT FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003994 all species →	Molecular Function	aconitate hydratase activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006099 all species →	Biological Process	tricarboxylic acid cycle	Interproscan
GO:0006101 all species →	Biological Process	citrate metabolic process	Interproscan
GO:0030350 all species →	Molecular Function	iron-responsive element binding	Interproscan
GO:0051539 all species →	Molecular Function	4 iron, 4 sulfur cluster binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01681	ACO, acnA; aconitate hydratase	EC:4.2.1.3	Carbon fixation pathways in prokaryotes	ko00720	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003823-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

349.0Max TPM

146.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	90.60	148.60
polyp at pH7 6	18	18	105.53	147.45
coral polyp · control treatment	16	16	186.94	331.68
coral polyp · oil and dispersant treatment	16	16	203.43	348.95
coral polyp · oil treatment	16	16	157.49	212.78
coral polyp · dispersant treatment	16	16	165.80	268.17
Polyp	10	10	111.91	165.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	148.60
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	130.16
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.80
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	100.44
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	98.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	92.01
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.29
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	90.42
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	89.95
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	89.27
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	89.27
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	87.45
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	83.67
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.85
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	71.49
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.96
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.78
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.70
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	147.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	146.13
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	143.71
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	135.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	132.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	132.20
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	126.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	121.07
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	101.59
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	96.07
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	91.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	89.83
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	88.41
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	83.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	79.73
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	78.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.73
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.98
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	331.68
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	237.58
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	233.74
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	232.22
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	229.58
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	213.95
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	201.22
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	185.78
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	182.80
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	164.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	162.92
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	162.22
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	130.18
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	115.86
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	113.14
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	93.53
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	348.95
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	267.75
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	253.27
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	238.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	236.78
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	229.07
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	219.89
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	216.54
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	208.89
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	202.49
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	186.36
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	170.46
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	165.13
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	127.64
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	103.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.53
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	212.78
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	207.87
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	190.66
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	179.45
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	177.20
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	176.91
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	174.02
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	170.80
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	148.33
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	146.56
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	144.84
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	141.62
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	131.97
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	122.97
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	112.20
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	81.67
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	268.17
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	242.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	212.94
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	196.95
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	191.84
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	179.81
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	177.26
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	168.00
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	167.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	144.66
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	130.16
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	126.04
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	121.14
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	120.55
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	109.80
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	95.33
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	165.17
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	133.37
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	129.24
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	125.95
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	114.65
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	106.32
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	101.76
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	99.08
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	85.62
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	57.91

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.