Gene detail

Detailed information of OS493_003852-T1 in Lophelia pertusa

Genomic Location: scaffold_7:6481172...6493499
NR annotation: KAJ7394172.1, Phosphoserine aminotransferase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003852-T1

ATGACTGACACAGACAGACGAGTTTTGAATTTCTCTGCTGGCCCTGCCAAACTGCCGGAAGAAGTTTTGGCCCAAGCTCAGAAGGAGCTGCTCAGTTATGGAAACCTTGGAATAAGTGTTATGGAAATGAGCCACAGATCTGCCACCTTTACAAAAATTGTCAATGAGGCTGAAAGTGACCTTAGAGAATTACTTAATATTCCAGACAACTACAAGGTTCTGTTCCTTCAAGGAGGCGGCACAGGTCAATTTGCTGCAATTCCTCTGAACTTGGCTAAAGAGGGAGCATCTGCTGATTATATTGTAACTGGAGCTTGGTCAGCAAAAGCTGCAAAAGAGGCAGAAAAATTTGTCAAAGTAAATCCGGTTTTCAAGAAGCTGGACAAATACAACAGAATTCCCCAGCAGGAGGAGTGGAATTTGGATCCAAATGCTTCATATGTCTACTATTGCGCCAATGAAACAATTCATGGAGTGGAGTTTGATTTTGTCCCAGAGACAAATGGAATACCACTCGTCTGTGACATGTCCTCCAACATCTTGTCAAGACCTGTTGATGTCAGCAAGTTTGGACTGATCTATGGTGGAGCTCAAAAGAATGTCGGTTGTGCTGGAGTTACCCTGGTTATTGTGCGAGAAGATCTGATAAGTACTCCTTCACCACAGTGCCCGGTTGTTTTTGACTATAAGATTCAGGCTGGTATGAACTCGTTGTACAACACGCCTCCGACATACAGTATCTACATCATGGGCCTGGTGTTCAAGTGGCTGATAAAAAATGGAGGAATTCAAGAAATCAACAGAATTAACCAAATGAAGTCAGATCTCTTGTATGAACTCGTTGACTCTTCAAATGGGTTCTACTGTGGCACAGTGGAAACTAAGAGCCGTTCAAGAATGAATGCTCCATTCAGAATTGCCAGCCCTGGAGGAGACCAGGAATTGGAAAAGATGTTCCTTGAAGAAACAGCCGCTAAAGACATGATCCAGCTCAAGGGTCACAGGTCTGTTGGAGGAATAAGAGTGTCGATGTACAATGCTGTGAAACTTGACGATGTTAAGACACTTGTGGATTTCATGAAAGACTTCAGACAACGAAATCAAAAGCAATCACAGCGACACGGTAGAGAGCCAGTTGAAGCTAAAATGAACAAGCTAAAGGAAGACAAACTTTCTGTTACGATGAAAGGAGCCATAGCTCGCAACTCGGCTGCTGAAAACAAAATGAAGGCTAACATGAACGCCATGAGTTATGGCAACCAGAAGTGTCTACAGAGCTTGGAGTATTGCAAAAACAAGTACGAGAAGCGACAGCGAGAGTTGCAAAACGAGAAACAGCGAATGTTGCATCATCGCCGCTTGAGTGACGAAACAGCCTCAAGAAAGATTTCAGCTCCAGCTTGTATGGTAAGCGTTGTTGAATACAAAGATATGTCATCAAGCGGTGAATTCATCACAGATTTACAAAGGATTGGCAGCGCGCGTGTAAGACCGAGATCGAGTTCTTTTACTAACGGCGGTAGGTTGCCCTCGCTTGCTCGCGGGAATGGCGGGAACTCGCCGGAGCCGTTCAACGCAAAGAACGGCGGACTTACACTTCCAGCTATTGAACCGAATGGAAGTAGCCATGGCCGGCAGCGCAGGCTTTCCGCGACAAGCTTGTCAGTTCCAACCATGACAAGTGTTACTCAAGCCAGGTCTGCCCCTAGTTCGCCATCCGCGCCCCGCCGAGAGTTCGCTGGGATTCCATCTCCAAGACTCGGTCGCAGCAAGTCTCCCGCGAGGGAATTGGGAGGAATACACTCTCTTTTGGATAACGCGCGAGAAAAACAGATGCAGCTTCTGTATTTCGCTTCGGCCAAAATGAAAGAAAACCGCTTAGAACGGCAGCAACCATTCGACGAGGCTGAAACAGAGCAAAATGTGAAATCATCTTTGGCAAGTTTTGAAGAGAGTCAAGACAACCCAAAAACTAGAAAGATATCTAGCCCCGGCACTGTTTTATCTCCAGTATCATCTCCAACACCCCCCTGGAACACGCTACTAATGATGATGAAGAGTCAACATTGGAGAAAAATTTCGATCAAATTCGATATTGCCAATACCTTAGAACGCCTTCTCTGCCGGAGCAGGATGACGAAAGATTACCCGATGAACTGA

Transcript

OS493_003852-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P10658	Phosphoserine aminotransferase OS=Oryctolagus cuniculus OX=9986 GN=PSAT1 PE=2 SV=1
Q99K85	Phosphoserine aminotransferase OS=Mus musculus OX=10090 GN=Psat1 PE=1 SV=1
Q9Y617	Phosphoserine aminotransferase OS=Homo sapiens OX=9606 GN=PSAT1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004752 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00266 all species →	Aminotran_5	Aminotransferase class-V	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020578 all species →	Binding_site	Aminotransferase class-V, pyridoxal-phosphate binding site	Interproscan
IPR022278 all species →	Family	Phosphoserine aminotransferase	Interproscan
IPR015424 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase	Interproscan
IPR015421 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase, major domain	Interproscan
IPR015422 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase, small domain	Interproscan
IPR000192 all species →	Domain	Aminotransferase class V domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43247 all species →	PHOSPHOSERINE AMINOTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004648 all species →	Molecular Function	O-phospho-L-serine:2-oxoglutarate aminotransferase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006564 all species →	Biological Process	L-serine biosynthetic process	Interproscan
GO:0030170 all species →	Molecular Function	pyridoxal phosphate binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003852-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003852-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

72.5Max TPM

20.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	28.28	64.80
polyp at pH7 6	18	18	21.56	44.78
coral polyp · control treatment	16	16	20.00	72.47
coral polyp · oil and dispersant treatment	16	16	17.05	31.00
coral polyp · oil treatment	16	16	16.53	29.11
coral polyp · dispersant treatment	16	16	15.71	30.23
Polyp	10	10	22.26	65.89

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	64.80
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	64.26
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.43
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.30
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.03
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.64
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.28
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.98
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.91
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.95
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.24
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.04
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.51
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.47
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.41
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.79
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.78
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.45
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.23
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.07
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.87
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.75
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.49
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.39
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.43
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.04
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.44
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.75
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.26
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.52
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.21
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.52
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.47
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.22
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.95
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.94
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.40
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.69
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.71
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.01
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.55
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.23
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.00
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.99
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.84
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.59
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.75
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.71
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.71
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.08
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.85
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.38
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.92
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.34
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.32
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.98
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.11
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.48
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.26
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.16
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.42
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.28
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.02
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.27
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.17
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.76
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.35
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.02
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.04
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.90
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.92
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.86
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.57
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.07
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.94
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.27
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.20
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.90
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.81
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.33
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.59
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.40
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	65.89
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	36.10
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	28.17
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	21.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	20.62
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.31
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.33
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.42
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.88
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.55

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.