Gene detail

Detailed information of OS493_003853-T1 in Lophelia pertusa

Genomic Location: scaffold_7:6499542...6505840
NR annotation: KAJ7394173.1, anaphase-promoting complex subunit 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003853-T1

ATGAAACCAGTAACAAAGAACTTCAGTATCAATAACATGGTGATGGAGGAGAGGATGAGACAAGGACAGCCGCCGCCCTGGCACGAGCAAGAAGAGATAGATTCCACCAGAGACTTTGCTACACAATATCGCAAAACACGATCAATGGAGAACTCGCGCCGTCCATCAGAGGAGAATATTTATCTGACCCCACCCTGGATGGAAGATGAACGGCAATCCTGCGGGGGTCGACCTGGCTCAGATCATTCTTCAAATCGATCATACCGAATCACGCTTGAAGAGCAGCGAGCCATTCAAGAGGAGGTCAGAAGCACAGGGATTGCAGAGGCTGGGGATAAAGTACAAGCACTCCGTGAAGAAAAAGCTGCAGACAAAGCTGTCCCTGGTGTTGTACAGCCGGTGCCTGGTAGAGACAGTGGATTCTGTAGCGAGCAAGATCAGCTCGCGCAACAGGGACAAGGCCCAGCAGCTGATGGCTTACCTAGTGACACGCTGACGCAGGGGGATCCACTAATCATTAAAGACGTTATCAATGTAGACGCCCCTGTAGAGAAACCACCTGTTAGCTCGTTGCAGAGCAATAAATCAACAGCAACTCAGACCCAGACCTCAACCAAAGCTACAATGGAACTTTACAAGCCTACCATCTCAACCAAAGCTACAATGGAACCTTACAAAGCTACAGTGGAACCGTACAAACCTACAGTGGAACCTTACAAGCCTACAGTGGAACCTTACAAGCCTACAGTGGAACATTTCAAGCCTACAGCGGAACCTTACAATCCTACAGTGGAACATTTCAAGTCTACAGCGGAACCTTACAAGCCTACTGCTCTGAAGCCAGCCGAAGACACCAGGCTTGTCAGTCAACCGTTGCCTAGCAACAGAGAAATGCCCAGCAGGTGCGCTGCTCCCCGAGATATAAGAGGTGGTGTGGACGCGACAAACCATAATGGCGGCGAATCGGGTAGCCACAATAGAGGCCTTACCAGGAGTATCAGCCAATCAAGTCTGGAAGCCATCTGCTATTCACCGCATGACGCTTTAGATGGCTTGGAGACATCCAGCGTGGTCAGTTTCGCCAGCACCGCTGCGACTCATCATGATCTCGACACACGAATTGACATGGTGCAGTCGCTGTTATCCATGCTAGGAACCCATGACAAAGATGACATGTCACGGACTTTATTAGCCATGTCTAACAGCAAGGATAGCTGCGCAGCCATGCGACAATCGGGTTGTCTACCGCTACTTATTGATCTGCTGCACGGCAAAGACTTCACGGACAAGAATGCGCGTCGCGAGGCCCGCGCGCGTGCTGGCCTCGCGTTACATAACATTGTTTACTCGAACGTGGAAGACAGGCGTGGACGACGCGAGGTGCGAGTTTTGAGGCTGCTGGAAATTGCGCGTGCGCACTGTGACGTTGTGCAGTTTAAAGGTTTCCCAGTGCATCCGTGCGCGGAACGTTGGTATCCACCCCTGAGGGATCATGGGCCGGGCCCGGCTATCGCCGCGCTTATGAAGTTGTCGTTTGAAGAAGATCATCGCACGGCCATTTGTGAGCTTGGTGGGCTTCAAGCTATCGCAGAACTCGTCCAAATTGATCATCAAGTCAACGAAACTTGCAAAGACGCCTATAGCATTAATCTGAGGAAGTACACGGGTATGACAATTACGAACCTGACGTTCGGAAACACCAAGAATAAGAGCCTGTTATGCAACATTCCAGGTGCTGTTGACGCCATTATCGCTCAGTTGAACACTGTTGAAGAAGAGGAGATCATCCAAGTCTCTGCCAGCGTGCTTAGGAACCTCTCCTGGAGAGCCGACGAACTGTGTCGCAAGACATTACGCGATGCAGGCGCAATAAAAGTGTTGCTGTCCGCGGCCCAAGCAGTGCATGGAGAACCCGCCCTGAGAACGACCCTTAGTGCCCTGTGGAACCTTTCAGCTCATTGCTCGGATAACAAGGCAGAGATTTGTGCGTCACAAGGTGCCCTGAAGTTCCTCGTCAAGTGCCTTAACTACTCCAGCCCCTCTGGTAACATCTCCGTGGTAGAAAGCAGTGGAGGGATTCTCAGAAATCTTTCTTCTCATATTGCCGTGCGACCAGACTATCGTAAGACCCTCCGTGATAGTGGATGCTTTCAAATCGTGCTCTCTCATCTCCGCTCTCCAAGCCTGCGAGTCGTCAGTAATGTCTGCGGTGCCTTGTGGAACTTGTCTGCTCGGTGCGTAGAGGATCAAGAGCTTCTCTGGGAACTCGGTGCTGTGTCGCTGCTGAAGTCTCTTATCAACTCCAAGCACAAAGCCATCTCTACTTCATCAGCCGCGGCTTTACGCAACTTGATGACCGTGAAGCCGGGAAGCTCCACGGACAATGAGTCAGTTTCTTCCAGAGCTGCCAGACACTATCGGAGCATGCCCGCAAACATGCGATCAGCGGACGCTCAGGCCAGAATTAAAAGCGACGCTGCAAGAGTCAGGAATCGTTCTCCTAGATCCCAGTCTCCATTGCTCCATGGCCAGGTTACCCAGCAGCCCCTTACCGTACGCCAGGCTGCTAAGCAAGATTATGAAGCTCCCGCTTACTCTCAGCTTGGAAATGCGGCGAATAAACTCCAACAAGGCTTGGTTCCCCAGCCGCTACGCCCCCACGGCCCGGTGACCAAGCAATCAGAGGACTACAGTTCGCAGCCATTCTACCCAGCAGGCCAAGCTGCTGTCATCCCAGTCACCAGGCAGGACATCGACGCGGCGGCACATCCACAGCAGCCAGGAAGAAAGAAGAATGGCTCCTCAGCCTCCCTCGCTCACTCAAGCTCCAGTTCGAACCATGCCGCCGTCCAGGAAGTAGAACCCAGCCCCTCTCTCTTGCGGAGCAGATCAGATGTCGGACCCCGGGCTCTCGCGGGCAGGCAGAAGAGAGCTAAGGCGCGTGCCGCTGACTCGAACAGTGTCGGTAGCGGGGCTTCGCTTGACGTTAAACACAACGCGCACTTTAAATGGAGTCAGAGCAATGATTCGCTGTCCAAGCATCGTCGCCAGCCTCGTAGAGACACCTCCTCTAAGCAAACTTATGAAAGACTTGATGGCGACCCTCGCGACTCTGGAGAAACAATGGAAAAACGTCAACATTCTCGTTCTTCCAGCGATGGCTGTGCGGTAATTCCGCTGTTGTGTGACTCGTACCCGTTACATGTGTCACGCATGTCACACAAGCCCAAGAGAGGTGACAGTTCAAAAGACAAGACTTCAGCCGAGACATCGGTGATGTCCAGGATCAGAAGTATGGCGCATAGGAACATGGAAGGAGGTAGCGGACACCCTCAGCATCCGGCAGCACAACAGGGGGATACCATGTCCCTGGTGTCTCCTTCTACAGCTCGGAGGCTCAACCAATGGACTAACACTTCTATGGGGGAGACTTATGAGCTGGCGGAGTTTGGTCCACAAGAGGCGAATCCACCGAGAATGTGCCAAGCAACAGACCAGCCCAGTACCTCCGCGTCTTACGATCGATCCAGCTCCAGTACCGCGCGGCCTAACCAGAGGCACACAACACAAAAGTTCAAATCGTACCGTGATTCAGACAGCGATCCAGACTCGGAGATAAATTCCGAGGAAGAACGACACCTGTTCGGCCATCCTCGGAAGGCGTCGGGTCATCCCGAAGCAAGCAATGCTTGGATCCAAAAAAGCAAACCCGAGGTTCATTCTCCTCGTTCAGCGGACACAGAAAGCGTGACCTCGTCAACATGCAGCTGTGATCAAGTGCAGAATGTCTGGATTCGCCGCTCGGAGTCCAAGAATCCAAAGTCTAGTGGTGCTTGTGGCAATTGTAGTCGCAGTCGTGCTGTCAAGGGCTCAGACAAAAACACTTCGAAGAAACCGATGGTGAAAAGTAGACGCGATTCCACCGACTCGCCCATATCCAGTCCCAGCATCCGTCGAGTGTTCAGAACGACGTCCGGTCGCGAGCACAAATCGAATTTCGATCCAAGCAAGAGAGGAGTTAAAGTTACATCACTCTAA

Transcript

OS493_003853-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P25054	Adenomatous polyposis coli protein OS=Homo sapiens OX=9606 GN=APC PE=1 SV=2
Q61315	Adenomatous polyposis coli protein OS=Mus musculus OX=10090 GN=Apc PE=1 SV=1
P70478	Adenomatous polyposis coli protein OS=Rattus norvegicus OX=10116 GN=Apc PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005919 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00514 all species →	Arm	Armadillo/beta-catenin-like repeat	Repeat	Interproscan
PF18797 all species →	APC_rep	Adenomatous polyposis coli (APC) repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000225 all species →	Repeat	Armadillo	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR026818 all species →	Family	Adenomatous polyposis coli (APC) family	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR041257 all species →	Repeat	Adenomatous polyposis coli (APC) repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12607 all species →	ADENOMATOUS POLYPOSIS COLI PROTEIN FAMILY	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0001708 all species →	Biological Process	cell fate specification	Interproscan
GO:0005881 all species →	Cellular Component	cytoplasmic microtubule	Interproscan
GO:0007026 all species →	Biological Process	negative regulation of microtubule depolymerization	Interproscan
GO:0007389 all species →	Biological Process	pattern specification process	Interproscan
GO:0007399 all species →	Biological Process	nervous system development	Interproscan
GO:0008013 all species →	Molecular Function	beta-catenin binding	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0016342 all species →	Cellular Component	catenin complex	Interproscan
GO:0016477 all species →	Biological Process	cell migration	Interproscan
GO:0030178 all species →	Biological Process	negative regulation of Wnt signaling pathway	Interproscan
GO:0030877 all species →	Cellular Component	beta-catenin destruction complex	Interproscan
GO:0045295 all species →	Molecular Function	gamma-catenin binding	Interproscan
GO:0045595 all species →	Biological Process	regulation of cell differentiation	Interproscan
GO:0045732 all species →	Biological Process	positive regulation of protein catabolic process	Interproscan
GO:0090090 all species →	Biological Process	negative regulation of canonical Wnt signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003853-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003853-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

51.0Max TPM

20.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.28	24.48
polyp at pH7 6	18	18	15.97	23.35
coral polyp · control treatment	16	16	24.27	42.23
coral polyp · oil and dispersant treatment	16	16	34.70	51.00
coral polyp · oil treatment	16	16	22.57	37.61
coral polyp · dispersant treatment	16	16	17.52	38.79
Polyp	10	10	7.31	10.86

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.33
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.84
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.34
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.13
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.80
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.38
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.70
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.81
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.29
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.29
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.28
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.08
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.74
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.47
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.38
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.35
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.64
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.26
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.36
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.64
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.52
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.16
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.66
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.45
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.58
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.74
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.13
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.04
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.97
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.62
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.95
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.23
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.71
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.74
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.54
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.12
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.52
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.31
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.30
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.31
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.84
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.67
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.87
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.79
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.33
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.82
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.31
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.23
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.06
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.66
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.02
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.26
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.53
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.79
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.69
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.66
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.06
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.61
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.65
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.64
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.84
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.78
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.46
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.01
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.62
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.84
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.68
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.42
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.65
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.97
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.79
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.96
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.46
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.59
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.15
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.94
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.58
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.57
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.45
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.39
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.61
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.52
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.77
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.63
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.89
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.16
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.46
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.96
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.25
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.22
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.94
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.27

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.