Gene detail

Detailed information of OS493_003892-T1 in Lophelia pertusa

Genomic Location: scaffold_8:70473...86020
NR annotation: KAJ7386934.1, putative ATP-dependent RNA helicase ddx60 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003892-T1

ATGGCTCTCACTCCTAAAGAAACTCTTCAACTGTATGACGTCATGACTCAGCAGTGGCCCGACAAAGAATCACTGCAGAAAATTTCTCCAGAGCAATATTTCCGGCTGGAAAATAAGTTCATTCCAAAGAGCCAAGTTCGACAGTACGAGAACGAGTTGAAGAAAGAATTCAAGTCCTGGGCCGATGGCAAACAGTTGACGAAGGTGCAATCCGTCATTCAGTCGTTGAATTCCGTTTATATAGAGAAGCAGACCTCAATTGAAAAAGAATGGAATGCGCAAGGAATGCCTTTGTCTGGTCAATTTTTCATCTTGAGAAATTTCCCAAAGCTTGTTGACCAACTGAGAGCGCAAGATCAACTGCCAGCCCTGGTGTTCAGCTTCGACCGCATGCTGTGCGAAAGGCTATCAGGAGTTCTCACTCTGGAATTTGAAGAACGAGAGAGAGTTCTAAGAGCACAAGGCGGCCCAAGAAGCTTATTAAAGCTGGCAGACAAGAGGAAAGTAAAAGCTGAAAAGAGATTGAAAACGGCCAGAGATAAAACAGAGAAAGAAAAAGGGAAACGGAGCAGCCAACTAGAAGAACAAGTCGACGAGGAAGACTTTTCAGCCTTGGATGAACCGTTGTCAGAATGTACATTGGCGATTACACACGGAATTGGAAAAGAGGATTTGAACAAGATAATGGGTCGCATCTGGTCCGTCAAAAGCAGTGACATATTCAAGCGCTCTTTGAAACGAGGAATCAGCTACCATCACGCTGGACTTAACAACAAAAAACGCTGCACTGTGGAAATGTTGTTTAGGGAGAAGTATCTCCAGGTTATCGCGGCAACGGGTACCTTGGCCCTTGGTATACATATGCCTTGTAAGACAGTTGTGTTTGCTGGAGACTCGCCCTTCTTAAACTCACTGCAGTACAGACAGATGTCTGGAAGGGCGGGTCGCAGAGCGAACATCCCAAAGCTTGTCGGGAACTTCCCTATCAACGTATCGCTGGTACTGCGCCTGCTCCTGATGACGTCAAAAGGAGACGACAAGGAAGATGCGCTCACTAAGGCTCTAGCACTGCTGTCTCATCCGTTCATCTGCCGGAAACATCCCGAGATGAAGAGTCAGATCAAGAAACATTTTCTGTTCAGCGTCGAACTTCTTGCTAGAATGAGTCTTATAAACAAAGAAAATGGCGCTCCTCAGGAGATGGCTGGACTCGCCACCCATCTTCACTACCACGAGCCCTCCAACTTTGTCTTAGTCAGTTTTGTGCAACGTGGACTCTTTCACAAACTTTGTCAACCAGGAACAAACGGCAAATTTCCTGAAGACGTCACAAGGAAAATGGTTCTTGTTCTAACCACTTGTTTGGCAGAATATTCCTTCATGCAAACTTCAAGCGAAGGATCCACTCTTGCCCGACATCAAAAAGTCAGACATCTCTTCAATAATCCTTTACGATCAGAAAGAGTGATTTTGGAGGATCTCCCGGATGAATTTGCTGAAGCGCTTCAAGATTACAACCGTCAGGTTACAGATGTCTTCAGCCAGTACCTCACCACAGTGGCCGCTGAACTTGAAAAGGACCGAGGAGAGGAAAACAAACTCCCTTTATCAGGAATTGAATTTCCAGATCAGGCGAGCATTGCCGCCGACCTTGCCGCGGAGCATGACATCATCAAAAGCCTGGCGCGCTCTTCCATTCTGTATTCCGCTTGTTCGTCATTCACTGCACTGTCAGGAAATTCAGACCTGCAGTTGCATTCTTCTGGCCAAAATGCAGCCGTAAGTGAGAAATTTGAAGAAAGCAGTGTCTGTGACGAGGACAAGAACTCTACAGAAGCTGGTAGCAGCCAAAGCGACGAGAAACGCGAAGACGGCGAGACCGTAAACGACGAAAGTAAAGACCAACTTGAAAGTGATGAAGAAGACGATGTGGAGGGGCATCGCAAGCAAATTGATCATTTGTTGAAGATTGTTCGTCAGGATGTCTACACAGACATGAATGTCGTCCCCATTCTTCCTCTCAAGAAATACAACTCAGTCGGGCGTGTTCAACACTTGAACGCTTATGCTCTGGATTTCTTCAAGCACGGATCCTGCAAAGTTATTGAGAAAGAAAATGGAATCAGGGCTGGCGAGGTTTTCAATGTGCTGAAGGACTTTGGCCTTACCATTAAATCAATCAGTTGTTCATTGGAGGAGCTGGGACCTGAAAGTGATAATGTGGTGCTCGCCTTCAAGCAGTTGGCCCAGGAGTTCGGAGAAAAATTCCAAAAGCAATACAAAAAAGACATATGA

Transcript

OS493_003892-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IY21	Probable ATP-dependent RNA helicase DDX60 OS=Homo sapiens OX=9606 GN=DDX60 PE=1 SV=3
Q5H9U9	Probable ATP-dependent RNA helicase DDX60-like OS=Homo sapiens OX=9606 GN=DDX60L PE=1 SV=3
Q9P7T8	Uncharacterized helicase C694.02 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=SPAC694.02 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001372 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR052431 all species →	Family	SKI2 subfamily ATP-dependent RNA helicases	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44533 all species →	DEAD/H RNA HELICASE, PUTATIVE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003892-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003892-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

63.0Max TPM

28.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	33.05	50.33
polyp at pH7 6	18	18	27.81	44.55
coral polyp · control treatment	16	16	34.14	62.96
coral polyp · oil and dispersant treatment	16	16	24.22	47.01
coral polyp · oil treatment	16	16	27.81	45.41
coral polyp · dispersant treatment	16	16	24.36	41.69
Polyp	10	10	22.77	39.01

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.33
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.91
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.70
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.40
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.17
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.78
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.50
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.65
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.62
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.94
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.47
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.82
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.42
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.31
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.27
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.60
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.55
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.96
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.19
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.83
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.27
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.08
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.67
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.20
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.68
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.37
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.06
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.79
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.43
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.98
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.85
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.82
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.48
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.61
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.22
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.42
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.80
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.08
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.18
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.52
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.09
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.84
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.67
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.04
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.14
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.25
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.01
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.16
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.12
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.95
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.40
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.79
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.98
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.45
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.40
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.90
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.32
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.57
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.22
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.28
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.18
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.23
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.99
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.37
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.59
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.57
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.85
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.74
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.04
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.21
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.32
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.14
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.10
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.97
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.69
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.56
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.02
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.21
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.26
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.40
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.01
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.23
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.49
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.36
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.29
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.06
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.09
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.48
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.41
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	39.01
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	36.81
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	31.20
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	30.31
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	23.39
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	18.14
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.94
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	12.87
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	9.85
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.12

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.