Gene detail

Detailed information of OS493_003898-T1 in Lophelia pertusa

Genomic Location: scaffold_8:146844...168062
NR annotation: KAJ7386940.1, putative ATP-dependent RNA helicase ddx60 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003898-T1

ATGGCTCTCACTCCTAAAGAAACTCTTCAACTGTATGACGTCATGACTCAGCAGTGGCCCGACAAAGAATCACTGCAGAAAATTTCTCCAGAGCAATATTTCCTGGAAAATAAGTTCATTCCAAAGAGCCAAGCTCGACAGTACGAGAACGAGCTAAAGAAAGAATTCAAGTCCTGGGCCGATGGAAAACAGTTGAAGAAGGTGCAATCCGTCATTCAGTCGTTGAATTCCGTTTACTTAGAGAGACAGACCTCAATTGAAAAAGAATGGAATACGCAAGGAAAGCCTTCGTCTGGTAAATTTTTCATCTTGAGAAATTTCCCAAAGCTTGTTGACCAACTGAGAGCGCAAGATCAACTGCCAGCCCTGGTGTTCAGCTTTGACCGCATGATGTGCCAAACGCTATCAAGGGTTCTCACTCTGGAATTTGAAAAACGAGAGAGAGTCCTAAGAGCACAAGGCGGCCCAAGAAGCTTAAAGCTTGCAGACAAGAGGCGAGTAAAAGCTGAAAAGAGATTGAAAAGGAGCAGAGATGAAACAGAGAAAGAAAAAGGGAAACTGAGCCAACTTGTAGAACGATGTCAAGATGAGGAAGACTTTTCAGCCTTGAATGAACCTTTGCCAGAATGTACATTGGCGTTTACACACGGAATTGGAAAAGAGGGTTTTAACAAGATAATGGGTCGCATCTGGTCCGTCAAAAGCAGTGACATATTCAAGCGCTCTTTGAAACGAGGAATCAGCTACCATCACGCTGGACTAAACAGCAAAAAACGCTGCTGTGTGGAAATGTTGTTTAGGGAGAAATGTCTTCAGGTTATCGCGGCAACGAGTACCTTGGCCCTTGGTATACATATGCCTTGTAAGACAGTTGTGTTTGCTGGAGACTCGCCCTTCTTAAACTCACTGCAGTACAGACAGATGTCTGGCAGGGCGGGTCGCAGAGGTTTTGACCCGGTGGGGAATGTTGTGTTTTTTGGTGTTCCTTACCGGAAGGTTCAACGCCTCATCACAGCGAACATCCCAAAGCTTGTCGGGAACTTCCCCATCAACGTGTCGCTGGTACTGCGCCTGCTCCTGATGACGTCGAAAGGAGACGACAAGGACGATGCACTCACTAAGGCTCTAGCACTGCTGTCTCATCCGTTCATCTGCCGAAAACACCCCGAGATGGAGAGTCAGATCAAGAAACATTTTCTCTTTAGCGTCGAACTGCTTGCTAGATTGAGTCTTATAAACAAAGAAAATGGTGCTCCTCAGGAGATGGCTGGACTCGCCACCCATCTTCACTACCATGAGCCCTCCAACTTTGTCTTAGTCAGTTTTGTGCAACGTGGCCTCTTTCACGAACTTTGTCAACCAGGAACAAACGGCAAATTTCCTGAAGACGTCACAAGGAAAATGGTTCTTGTTCTGAGTCATTTGTTTGGTAGAAGATTCCTTCATGCTTCTTTCAAGCGAAGGATCCACTCTTGCCCGACATCAAAAGTAATTTTGGAGGATCTCCCGGATGAATTTGCCGAAGCGCTTCAAGATTACAACCGTCAGGTTACAGATGTCTTCAGCCAGTACCTCACCACAGTGGCCGCTGAACTTGAAAAGGACCGAGGAGAGGAAAACAAACTCCCTTTATCAGGCATTGAATTTCCAGATCAGGCGAGCATTGCCGGCGACCTTGCCGAGCATGACATCATCAAAAGCCTCGCGCGCTCTTCCATCCTGTATTCCGCTTGTTCGTCATTCACTGCACTGTCAGGGAATTCAGACCTACAGTTGCATTCTTCGAGCCAAAGTGCAGCCGTAACTCAGGAATTTGAAGAAAGCAGTGTCGGTGACGAAGACAAGAACTCTACTGAAGCTGGTAGCAGCGAAAGCGACGAGAAACGTGAAGACGGCGAGACCGTAAACGACGAAAGTAAAGACCAACTTGAAAGTGATGAAGAAGACGATGTGGAAGGGCATCGCGAGCAAATTGATCATTTGTTGAAGATTGTTCGCCAGGATGTCTACACAGACATGAATGTCGTCCCCATTCTTCCTCTCAAGAAATACGACTCAGTCGGGCGTGTTCAACACTTGAACGCTTTTGCTCTGGATTTCTTCAAGCATGGATCCTACAAAGCTATTGAGCATGAAAATCGAATCAAAGCTGGCGAGGTTTTCTTTGTACTGAAGGACTTTTACCTTGCCATTAAATCAATCAGCTGTTCATTGGAGGAGTTGGGACCTGAAAGTGATAATGTGGTGCTCGCCTTCAAGCAGTTGGCCCAGGATCGTATCACCATGAAGGAAGGTTGGTACATGGTCATAGTCGGACTTCCAGCCTTTATGACCGCTTATGGTCCGTTTATGATCCTCCTTATGATCGGTTACCAAGTCAAACATCTTCGACGCTGGATTGCCACTTATGCATTTTATCGCATCATCCAGACGAAACCTGACGACCTCGGAGAGAAGAGATGGTTGTTTAAAGACATGGATCTTACAAACGAGAAAAAAATCTTGTCCAAGGTTCTATCGAGCTTGTTCTATTTGTTCCTGGTGATGTTCGGTGGTGTAGTACTGATGTTTTATACACTGCTTCTGCTCGACGTCACCTTCAAGTGTGATCCCAATGATAAGTCACTGGATTGTTTTAAATTCATGATTCATGATTTGGAGACGGTTAAGAACTTTTCCAGGGTAAGAATTGATTGTAACAGCGCTGCAGCTAAGAATGGAACCGTAGACGTGGTATGCTACAAGATTGTCCTCAACTTTGGCTTAGCTGCGGGTGCTAGTTATGGTTCATTCCAAATAACCATGGTGTTCTTACATTTGGCAACGGCTGCGTTTCTGATGATCAAACAAGCAGCGACTATATGCATGATAAGAGCGCTCCTAGCAATGCTGTCCTTGGTGATTATCGCGGGAGTTGCAGTTGTTCAACTAACCCCAGCTTTGCATCGTCACTTGATATCTGATAAACTGGGTTCTTGCCCTTCAAACGATGGTATCTGTGATCACTGGATATCTGTTCGTGTTTGGAATCCCTTGGAAGAAGCTCATCGCATTAAAGGCGGCGGATAA

Transcript

OS493_003898-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IY21	Probable ATP-dependent RNA helicase DDX60 OS=Homo sapiens OX=9606 GN=DDX60 PE=1 SV=3
Q5H9U9	Probable ATP-dependent RNA helicase DDX60-like OS=Homo sapiens OX=9606 GN=DDX60L PE=1 SV=3
Q9P7T8	Uncharacterized helicase C694.02 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=SPAC694.02 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001372 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR052431 all species →	Family	SKI2 subfamily ATP-dependent RNA helicases	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44533 all species →	DEAD/H RNA HELICASE, PUTATIVE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003898-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003898-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

17.6Max TPM

7.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.94	17.55
polyp at pH7 6	18	18	6.49	9.69
coral polyp · control treatment	16	16	7.91	12.88
coral polyp · oil and dispersant treatment	16	16	6.13	10.81
coral polyp · oil treatment	16	16	6.45	11.18
coral polyp · dispersant treatment	16	16	7.46	12.97
Polyp	10	10	4.81	7.32

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.55
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.17
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.04
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.39
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.64
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.37
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.78
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.78
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.69
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.56
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.33
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.25
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.20
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.18
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.07
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.03
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.84
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.69
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.64
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.66
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.86
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.78
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.63
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.45
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.20
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.09
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.99
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.37
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.25
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.54
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.46
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.81
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.88
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.75
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.14
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.66
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.06
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.15
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.86
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.68
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.94
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.92
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.15
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.89
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.77
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.17
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.81
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.81
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.82
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.78
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.52
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.94
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.41
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.34
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.28
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.90
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.96
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.94
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.31
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.18
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.97
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.63
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.50
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.98
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.63
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.76
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.47
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.09
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.15
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.42
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.95
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.44
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.86
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.97
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.56
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.29
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.47
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.41
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.31
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.81
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.75
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.25
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.05
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.02
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.26
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.34
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.13
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.32
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.06
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.88
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.35
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.31
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.74
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.78
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.71
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.99

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.