Gene detail

Detailed information of OS493_003900-T1 in Lophelia pertusa

Genomic Location: scaffold_8:180405...196351
NR annotation: KAJ7386942.1, hypothetical protein OS493_003900 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003900-T1

ATGACTAAAGCCCCTCCAAGTTTCCAGAGTCCAGTTTCAACTCAGGAGCTTGGAAGATTATGGGCTGGGTATAATCCCGCAACAGATAGTCACAACTTAGAAAATGTCAGAGAGAATAACACAGCTCTTCAGTGTCACAAAGCTCCAGTTATGACGCAGGAGCTTGAAAGGCTGTGGAGTCACAATCCTGGTGTGGAAAGCCTGGCCGATGTTGACTCTCAGGTTGACGAACAATCAGAGGTGGACGCTATGAGTGGAGTGTACCCTCTCTATGATTCTGAGCCCGAGTTGGGTGCGAATGAGATGGAAGAAGTAAACGCGGAAGAAGATATGGATTCAGAATCAGAAGATGAGGAAGAATTCGAAGAGACTCTTGAAAGGAATACAACTGTAATAGAATTGGAGATTCATCCTAAGGATGCCACAGGAATGAATGAACAGCAGCTGGATGAAAGCAATGTTGAAGTTGATGACGAAATGAGACCTATCAAGCCAGGCATAGGAGGAGTATCCTCTGTCAAGACATTCGAGGAACTCTTAGAACAACAACTCAAACTTGATGAGGCTTCCAAAACAGTGGCAACAACCCAAAGTGCAATTCAAAAGCCTCAGAGAACATTTCTAAGGAAAGGTCAAGGACTTGCCAGATTTAAAGGAAAATCAGCCTCAAGTAAGGCAGGTGCTCAGAACCAGGAAGCTGCTAGTCAGGCCACAACAGTGCCACAGAGAAAGGACAAGAAGGCTGGGAATGCTGTGTCCAATAATAAACCAAGTGGAGGTCCTGTGGCACAGAGCCGGGTCACACGTAAGGTAGCATCTAGGAGTCCTCAGGTGGTGGCAGAAGCAACTGAAGCAGCCACATTTGGGAGGCTGCAACAATCCCGAGGCTCTAACGGGCCAAAATCCCAAGCAGCTAGTTCAGGCCAAACAGCAGCCTTGGAAGAAGAAGAGCTTGAAGAATTTGAGCTTCTGGAACAAGCTGCGGCAAATGCTTCCTTCTCGTCCAACTCCTCAGTGGTGGTCAAAGTGTTGGCCAAAGCTAGAGGAAATACACTGGACAGTAAACATGTCATCAGTGGACGAGGTGTAGACAGTACCAACAACAGAGGTCCAGGAGGAATTCTGAGTCCTGTAGACACAGGTTATGGTAGTGGAGATGGCAAAGTAGCTTTATCGGTCGATGATCCTGGACACACTTGTATAGATGGTCGCATGAATGAACTTCAGGAGAATGATAGTGAAGATGAAGGTAGCGATGTGACACTGCAGGAGATGAGTTTGGACAGTGCCTTAGAGTTAGACAACGGTTGTGATGACAAAAGACAAACAGCTGGAGACCAACAGAAAGTCCTAGCTCCTCTGTACCTTCATCCAACTCCGTCACTTGCAATCGAGGATGACTTCAATGACGAGGAGACCTGGGGCGCAATAAAGAAGCACACAGGGACACGCCTTGAGAATGTAAAGAACAGCATCGAAGATGATTCCGATGATGACGATGACAGCGATGTAACAATCAGTGACATCTTCCCTCTTGCAATCTCCACCCCACCCGCACATTTTAAGGGTAGCCAGCATCAGAGGAGTACAGAGGCTGGAGGTAGTGGAGCTGATGGGTTGGTAGCGTCAACACCACCAACATCTGCCCTTGTTTCCAAGCTGTTTCCGCAGTTGAAGCCAAAGCAGAAAGCTGTTCAGCCTGCTACTAAACAAGCAGCCACTCGATCTGCTGGAGAAGAGAAGACGGAAGAGTCTGTAGACGCAATTCAAAGTATGGCTGTGAGGGAAAAACTCAAAGAGCTGGAAACAGAGATTGACAAGTTCAGAACTGAAAACGCAGCTTTGGCCAAAATGAGAAGTGAACGAGAAGAGGGCTTGAAAAAACTTCAGACGGAGATTAATGCATTCGAGAAACAGAAAACAGAAGAACTTGAACGATTGGAGCTGTTCAGAGAAGAAGAGCTCCGAAAGTTACGCCGTGAAAGACGAGTGTTTGAAAAATACCAGAAAGCCGCCCGTTCAATGCCAGACAAGAAGGAACGCGATGAAATCGAGAGCCTGCGAGGACAGACAGCAGAGTTGCAGGAAGAGCTTAAGCGACGTGAATCACGTTGGTCAGCGGCTTCGACTCGTAGCCGACAGAGGATCGAGGCCTTGGAGCAACAGAACAAAGAACTTCAAGATGAAGTGAAATTGTTAGAGCACTATCGACTACAACAGTGGAGAGAAGACGAGCAGTCCAAGGCAAAAGAAGACGAGGACTCAAGACCGAAGAAGCCTTTACAACGAAAGACTGCCAAGACAACTGAAGAAGAATCAGGACCCAGGCTTCCTCTGCGTCACCGCTCTCCTCCATTGAGACCAGATCTTGTCGAAGCTGTTCCCAGGTCGACTCCGGAAAATGCAACCGTTGATCCTGAGAACAGGCTGCTTATTACTGGCGTAGATGCAAACAATAACCAAGCCGCGAGGCCTCGCCCTGTTGATGAGAAAGATGCTTCAACAGATCAACTTTCTAAATCAAGCGAGGGAAACTCTGAACTAAGCTCTATTGCCAAGCCTCAAGAGGATTATATGCATGAAATACAGAAACCTAAGCAAAGCCCACGACGAAGAAGCAAGACACCAGACAGTGGTGAAAAAATGAAAAGAAACGTCCATTTCCAAGATGAAGAGAAGAATAACCCACATGACCCAGCAGAAAACAGCAATTTAAATGAGAGAACAACGAGACAAGATCCACGAGAAATAATGCATTCTGAGGGAAAGGTAGAGAAAGTGAACAGTGATGGCTCCCGCGTGATCTCCTTCGCAAACGGCACAAGAAAAGACATCAGTGTTGACGGCCAAACTGTCATCGTCACGTTCTTTAATGGAGACATCAAGCAAATTATGCCCGACCAGAGAGTGATTTACTATTATTCTGACGCTCAAACAACACATACCACTTATCCTGACGGACTGGAGGTCTTACAGTTTCCCAGTAAACAGATCGAAAAGCATTACCGCGATGGTACAAAGGAGATTATCTTCCCTGATCAGACTATCAAGTATCTGTACCCTAATGGAGCTGAAGAATGCGTGTTTAGTGACGGCACTATACAGAAAGTTAGTGTTGAAGGAGAAAGAACCATTGAATTCCCAAATGGGCAACGTGAAACTCACACCAAGTACTATAAAAAAAGGGAATATCCTGACGGGACAGTAAAGACCGTCTATCCCGATGGGCGTACGGAGACCCGTTACGCTACGGGACGGGTGCGGGTTAAAGATCGGGATGGACGGGTCCTAGTCGATTCTTCCAACCAAAACAGATGA

Transcript

OS493_003900-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q569L8	Centrosomal P4.1-associated protein OS=Mus musculus OX=10090 GN=Cpap PE=2 SV=2
Q9HC77	Centrosomal P4.1-associated protein OS=Homo sapiens OX=9606 GN=CPAP PE=1 SV=2
Q5BQN8	Centrosomal P4.1-associated protein OS=Pan troglodytes OX=9598 GN=CPAP PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002991 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07202 all species →	Tcp10_C	T-complex protein 10 C-terminus	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR026581 all species →	Family	T-complex protein 10 family	Interproscan
IPR047002 all species →	Homologous_superfamily	T-complex protein 10, C-terminal domain superfamily	Interproscan
IPR009852 all species →	Domain	Centromere protein J, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10331 all species →	T COMPLEX PROTEIN 10	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0015631 all species →	Molecular Function	tubulin binding	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0061511 all species →	Biological Process	centriole elongation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11502	CENPJ; centromere protein J	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003900-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

39.2Max TPM

5.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.20	11.82
polyp at pH7 6	18	18	6.12	11.05
coral polyp · control treatment	16	16	7.11	39.16
coral polyp · oil and dispersant treatment	16	16	5.49	37.91
coral polyp · oil treatment	16	16	4.66	8.59
coral polyp · dispersant treatment	16	16	3.53	5.73
Polyp	10	10	6.28	9.97

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.32
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.79
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.10
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.92
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.61
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.53
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.43
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.99
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.93
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.61
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.61
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.58
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.90
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.39
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.42
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.30
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.05
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.33
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.48
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.20
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.48
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.28
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.62
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.07
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.86
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.82
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.16
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.59
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.95
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.00
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.40
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.56
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.59
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.17
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.02
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.95
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.95
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.94
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.88
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.91
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.20
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.36
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.25
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.06
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.91
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.49
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.15
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.59
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.89
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.75
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.59
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.46
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.42
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.38
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.81
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.33
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.08
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.84
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.72
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.33
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.61
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.73
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.88
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.75
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.63
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.54
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.41
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.09
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.99
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.64
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.10
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.72
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.15
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.76
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.74
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.70
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.97
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.95
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.79
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.15
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.19
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.34
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.38
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.67
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.64

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.