Gene detail

Detailed information of OS493_004174-T1 in Lophelia pertusa

Genomic Location: scaffold_8:3040326...3053302
NR annotation: KAJ7387204.1, hypothetical protein OS493_004174 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004174-T1

ATGGCGCGCATGATGGAGGCGATTTTCGCCTTCGTTACAGTGTTCTCGTGCTTTCACCTTCTTGTACACACTTCCAAGGCTAAGCTACCGGGAATGCTATTTCCCAGAGATTCCGAGAGTCGAGAAGTGAAGGATTTGAGTGGATTTTGGACTTTCCGGGCGGATCTGTCTGCAAACAGGAACGCTGGGTTCGAACAGAGCTGGTTTGCTAAACCACTTTGGCAGACAGGTGAAGTCATCCCTATGCCTGTACCATCAAGCTACAATGACATTACACAGGACAAGGCCTTGAGGGACTTTATTGGTTGGGTGTGGTATGACAGGGAGGTTTATGCTCCTAAGACATGGAAATCAGACCAAATCAGGGTTGTTCTCCGTTTTGAGAGTGCACACTACAATACCAAAGTGTGGCTAAATGGCAAAGAAGTGATGACCCATTCTGGAGGCCACCTACCATTTGAAGCGGATGTCACATCACTGCTCTCCTATGACAAAGTCAACAGAATCACTGCAGCAGTGAACAACACATTAACACCTTCTACCCTACCCCCTGGGGAAATAAAATATCTCGTAGGGGATAGGTATCCTCCAGGATATTTTGTTCAAGAAACTACCTTTGACTTCTTCAACTATGCTGGTATTCATCGTCCTGTCAAACTCTACACCACCCCTGTTGTGTATCTATCAGACATCACCATAACAACAAGCCACTCTGATCAGGAGGGTGTGGTCAAGTTTGCTAGCACAGTGTCTTCGTCGCATTCTGTGAATGTGTCCATGAATTATGAACTTGTCGACAAGGCTGGTAATGTGGTAGCCTCAGTGGCAGGTCCTGACCTGTTTGAAGGAACACTGGTTGTTAAGAATCCAATGCTTTGGTGGCCGGTTGGAATGAGTGATCAGCCAGCATACCTCTACTCACTGAAGGTGACAACTCATTCATTTTCACCAGATGTGGATGACATCTACCATTTACCTGTCGGTATTAGGTCAGTTGAGGTGAAAGGAACAAAGTTTCTCATCAACAATGAGTCATTCTACTTCAAAGGCTTTGGCAAGCATGAAGATTCTGATATTCGTGGCAAAGGTATGGACTATGCTATCATTGCCAAAGACTTCAACCTGATCAAGTGGCTAGGAGCAAATTGTTTCCGCACCAGTCACTACCCATACGCTGATGAAATCATGGACATGGCTGACCAACAGGGAATTGTTGTCATCGATGAAAGTCCTGGAGTTGGAATTCAAAAAGCGAACTTCCGGAATGACACCCTCCATCATCACTTGGATGTCATGACTGAGTTGGTTCGTCGTGACAAGAATCGACCATCAGTAGTCATGTGGTCTGTAGCTAATGAACCAGGATCCAGTGATGTTGCAGCAGGACCATACTTCAAATCCGTAATAGAATTCACTCGTTCTCTGGACCCGACACGCCCTGTTACATTTGTTACTGCAGCAAGTGCTTACACTGACAAAGCCGTGCAGTATGTTGATGTGATTTTGTGCAATCGTTACTACGCCTGGTACCAGGACGCTGGACAAACACAACTCATTAGTCACCAGCTGGAGGGAGAGCTTAGAGCCTGGTTTGACAAGTTCCATAAACCAGTCGTACAGTCTGAGTATGGGGCTGATACAGTCGTTGGACTTCACATGGATCCACCTCTTATGTTTACTGAAGACTATCAGGTGGAAACTATTCAGCAGTATTTTCCAGTGTTTGATAAACTAAGGAAAGAATTCTTTGTTGGAGAACTGATATGGAACTTTGCGGACTTTATGACCAAACAACAAACGACGCGAGTTGTGGGCAACAAGAAAGGGATCCTGACTCGCCAACGGCAGCCGAAAGCCGCTGCTCGTGTTCTGCGCCAGCGATACCTAAACATTTCAATGGGAAGAAGTGGCAAGAGTGACGACGATGTGGACGTTTTACTCAGATTTGAGAGTTACAACATGGCAAACGTGGCTAGAATCGATAACGGGACATAG

Transcript

OS493_004174-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P08236	Beta-glucuronidase OS=Homo sapiens OX=9606 GN=GUSB PE=1 SV=2
Q4FAT7	Beta-glucuronidase OS=Sus scrofa OX=9823 GN=GUSB PE=3 SV=1
O18835	Beta-glucuronidase OS=Canis lupus familiaris OX=9615 GN=GUSB PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001408 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00703 all species →	Glyco_hydro_2	Glycosyl hydrolases family 2	Domain	Interproscan
PF02837 all species →	Glyco_hydro_2_N	Glycosyl hydrolases family 2, sugar binding domain	Domain	Interproscan
PF02836 all species →	Glyco_hydro_2_C	Glycosyl hydrolases family 2, TIM barrel domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036156 all species →	Homologous_superfamily	Beta-Galactosidase/glucuronidase domain superfamily	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR006102 all species →	Domain	Glycoside hydrolase, family 2, immunoglobulin-like beta-sandwich	Interproscan
IPR006101 all species →	Family	Glycoside hydrolase, family 2	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR006104 all species →	Domain	Glycosyl hydrolases family 2, sugar binding domain	Interproscan
IPR023232 all species →	Active_site	Glycoside hydrolase, family 2, active site	Interproscan
IPR023230 all species →	Conserved_site	Glycoside hydrolase, family 2, conserved site	Interproscan
IPR006103 all species →	Domain	Glycoside hydrolase family 2, catalytic domain	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10066 all species →	BETA-GLUCURONIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004566 all species →	Molecular Function	beta-glucuronidase activity	Interproscan
GO:0019391 all species →	Biological Process	obsolete glucuronoside catabolic process	Interproscan
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01195	uidA, GUSB; beta-glucuronidase	EC:3.2.1.31	Lysosome	ko04142	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004174-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

38.6Max TPM

11.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.98	24.52
polyp at pH7 6	18	17	9.31	23.74
coral polyp · control treatment	16	16	14.81	38.65
coral polyp · oil and dispersant treatment	16	15	10.31	21.92
coral polyp · oil treatment	16	16	15.16	33.90
coral polyp · dispersant treatment	16	16	11.83	25.85
Polyp	10	10	9.06	17.42

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.52
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.51
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.96
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.53
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.77
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.75
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.28
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.46
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.87
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.31
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.65
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.61
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.48
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.05
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.96
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.74
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.12
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.32
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.11
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.09
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.89
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.14
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.69
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.85
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.47
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.85
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.65
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.24
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.25
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.97
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.05
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.76
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.64
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.95
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.16
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.43
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.53
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.99
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.76
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.29
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.74
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.92
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.25
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.57
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.64
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.12
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.15
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.92
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.16
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.04
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.21
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.07
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.69
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.20
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.90
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.11
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.92
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.97
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.69
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.32
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.69
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.46
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.30
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.86
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.64
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.55
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.53
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.74
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.85
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.15
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.34
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.94
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.74
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.53
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.38
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.85
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.02
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.16
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.40
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	17.42
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	16.28
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.98
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.35
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.68
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.54
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.43

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.