Gene detail

Detailed information of OS493_004256-T1 in Lophelia pertusa

Genomic Location: scaffold_8:4296487...4317973
NR annotation: KAJ7387279.1, Breast carcinoma amplified sequence 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004256-T1

ATGTCTGTGGACTCTGTTGCAAGGAGAGTTTCTCGCGGCGGCGGACTCGTCGTTCGACCTCAAGCTATCAGCGACAAGTCCTACGTGGAGAGTGTGGTGAGCTTTCTACACGATGTCGTACCGCAGGCTGTAACAGGAGGACAGAAGCAGGAAGACAAGGAGAGAGTGTTGTGGGTGAAGTTCGAGGAAGCAGATATCAATGATAGCACACTTCACCAGGAGGACATTTCATCTGGACTGGCATTACCACTACTGTTGATTCTTGGTTACACAAATGGATTTCATGTGTGGACCATCCCATCAACTGGTGAAGCGCAGGAGGTGTTATCTCTTCGTCAGGGGCCGGTGAGGCTTGTACGCGTGCTCAAGACCCCATTGGAAGCTGCAACGTCAAAGGATGAGTTTGCAGATTCAAGACCTCTCTTTGCTGTATGTGATGCTGCAAGCCCCTCCTTGCCATTCTCCACAGTCAATCTGTGGTCACTTAGTACGGGTGAGCAGGTTCATTCTATTGGCTTCAAGTCTGAGGTATATGATGTGCTGTGTAACACAAGATTGATGGTTGTAGCCCTCCAAGAGAAGATAGCAGCATTTGATGCTTGTACCTTCAAAAGTTGTTTCTGTATAACAAGCTGTTACCCAGCCCCAAGCCCTAACCTCAACCCATTGGCACTGGGAACCAGATGGCTGGCATATGCAGATCGCAAGCTGGTACCTAACCATCAGTCCTGTGGGGGAGTGTGTGGGGACAATTCCCAGTCCTATACAGCTACAGTCATCAATGCTGCTAAGACACTAACCAGAGGCCTGACGATGTTTGGAGAGACAGTAGGACGCTGGACAGGAACGGAAGTCACACATGATTATGTTAACCAAAAGAAGTCTGTGATTAGACCAGGAGTCGTCACCATTATAGACACACTGAAAATTGGCAACGGAGAGTTCTGTGTACAGGAGGATGACCATGAGGGCTCTGGTATAGTGGCCCATTTTCCTGCCCATGCAGGACAGCCCCTATCTTGTATGGCCTTTGACCCCAGCGGTTCTTTACTGTTGACTGCAGACACTCTTGGAAACAACTTTCACGTGTACCACGTCCTTCCACACCCCATCTGCCCATCATTAAGCGCTGTCCATCATCTGTACACCCTCCACAGAGGAGACACCACTGCTACTGTGCATGGCATGGCATTTTCGTTCGATAGTCGATGGGTGGCCGTATCTACTGTACGTGGCACGGTACATGTATTTCCCATCACGTCATACGGAGGTCCCATAACAGTACGCACCCACTCCTCCCGTCGCGTGGTGAACCGAAGCAGCCGGTTCCACACCAGCGCTGGATTAGATGACCTGGATCAAGGGACCACATCATCAGGCCGACACAGTCCGTGCAACGGCACAGGAGGATCAAACCTGTCTTGCTCACCAAATGGAAGCCCGCTCAACTCCACAGGGACACCAATTGCCAGGGAATCTTCTTTGACGTTAGCTTCAACCAGCAATAATGGTTTAGTGAACCCCCGCCTCCCTCCTCTGCCACATTCCTACCTGATTCATCCATTTGCGCAGATAAGGACCCCTGATGGCCCACGATGTGGCGGACCCTGTTGCACTGGCTCGGCCCAGCACTCCAACAAGTGTAATGGCCGAGTAGGATTGGAGTATTCAATGGGTGCGGCGATGACGTTTGCCCCGTCTAGGGGATGGCTAGGAGGAAGTCCAAACACCGCCAGAGCAGAACCGTGCAGGTCTTCAGCTGTTGATTCGCTCTTCATACTGGACCTTCACGGCAACTTGACAGAGTACGTGATGGAACCACAGGGGGTTAAAACCGTGCCACAGAGTGATGACACCCCCCTGGAACTTGTTACTACATCAAGGGCACAGTGGATGCTAACAAGGTGCGCAACCTGGCCCGAAAGCAAGAGTCCTGTGATCAAAGACCTTTCTTTGTTGCTGGGGCGTTCAAACGTGGCCCCGAGTGAGCTTACTAAACGCATCGAAAAACAAGGAAAGAAAATTGGCATGGACAGTGAATCACTCATCGCCTACGCCCCCAAAGAGGAAGCGCATATCGACGGCTGCAACTCCGATGATCAGTGGCTGGCGAACATAGATATGGAGACCCACGCTGCCCCTCATCGGCGGCTCTGGATGGGTCCACAGTTCAACTTCAAGACCTACCAACCACCAGGGTCCTCGTCAGCTTCCTCTACCAACAGCCTAGGGGACTTCAGGTCTGGGGGCTCGGGTAGCGGGGCCACAATTGCAGCTCACAACAGGGACGGTCACCCAATGGACTTCTACTCCGAAGAACTGGATTTGCAAAGCTTGAGGCTGCAGCCCGTTCGCTCGGATCCAGTTCCCACCCCGTCAGGTCGGTTCGCGTTCACTGGGTGCGCATCGCCTAATCTAGGGGGGAGCATGCCACTTATCGTTGACAACGGCCCGGGAAGTCTAACAGACCCCTGGCCCGGCATGAATAATGAGATGTTCGAAGATAAAGAGGAACAACTCGTGGAAACATTGGCCGACGCCATGAACGATAACGCAACCCTACCGGTGAAAAATGGCAAAAAACGAACGACTTCTATCAACGGAGAAAACCAGTTCCAATTTCAGTCGGATTGTCTGGGGGGAGGGGTGAACGCGTTCGCCTCGTATTCCCCCGCGGAAACGAGCCCCCTGTTCCCACCCGATTGCAATTGGTCCTAA

Transcript

OS493_004256-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CCN5	BCAS3 microtubule associated cell migration factor OS=Mus musculus OX=10090 GN=Bcas3 PE=1 SV=2
Q9H6U6	BCAS3 microtubule associated cell migration factor OS=Homo sapiens OX=9606 GN=BCAS3 PE=1 SV=3
Q8SY41	Breast carcinoma-amplified sequence 3 homolog OS=Drosophila melanogaster OX=7227 GN=rudhira PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008907 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12490 all species →	BCAS3	BCAS3 microtubule associated cell migration factor, C-terminal	Domain	Interproscan
PF21034 all species →	BCAS3_WD40	BCAS3, WD40 repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR022175 all species →	Domain	BCAS3 domain	Interproscan
IPR048382 all species →	Domain	BCAS3, WD40 domain	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR045142 all species →	Family	BCAS3-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13268 all species →	BREAST CARCINOMA AMPLIFIED SEQUENCE 3	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006914 all species →	Biological Process	autophagy	Interproscan
GO:0042594 all species →	Biological Process	response to starvation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004256-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004256-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

104.2Max TPM

34.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.99	32.19
polyp at pH7 6	18	18	21.86	34.80
coral polyp · control treatment	16	16	39.25	99.97
coral polyp · oil and dispersant treatment	16	16	64.01	104.15
coral polyp · oil treatment	16	16	38.94	67.45
coral polyp · dispersant treatment	16	16	34.23	85.14
Polyp	10	10	15.77	23.71

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.19
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.68
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.96
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.46
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.95
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.85
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.54
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.11
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.35
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.05
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.97
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.74
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.99
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.34
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.80
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.44
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.53
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.40
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.66
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.10
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.83
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.50
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.83
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.83
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.80
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.83
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.64
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.12
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.88
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.50
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.41
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	99.97
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.71
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.80
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.28
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.34
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.88
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.40
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.45
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.27
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.68
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.30
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.23
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.07
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.39
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	104.15
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	95.49
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	86.57
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	81.13
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.77
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.56
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.99
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.18
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.08
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.58
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.56
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.64
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.65
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.20
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.27
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.28
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.45
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.77
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.06
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.88
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.76
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.62
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.53
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.93
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.01
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.10
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.46
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.16
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.74
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.63
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.14
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	85.14
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.48
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.64
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.97
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.28
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.20
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.79
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.98
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.72
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.57
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.01
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.48
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.86
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	23.71
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	21.75
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	21.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	20.87
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	19.37
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.54
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.59
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.37
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.13

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.