Gene detail

Detailed information of OS493_004324-T1 in Lophelia pertusa

Genomic Location: scaffold_8:5072459...5105344
NR annotation: KAJ7387336.1, Calcineurin-binding protein cabin-1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004324-T1

ATGAGGTTTTACAGTTTACTGTCGATACATTTTAAGATTCGTCTGTGTGCATTGAATGATGATTCAAGTGAGGAAAGTGATCATGAGCCTACTCAAGAGAGTGTTAAACAAGCCAAGGAATCAGAGGCTTTGGAGCTGTACAACAAAGGTCTGGCCTTGCAGCAGAAAGGAGATTACGCAGCATCAGAGGAAGCTTATAATCAGTTGTTAAATTCTGCCTTGGTTAAGGAGGCTCCCCCACCAGAGGATGATGCAGGCTTGGTTGAAGCTGGTCATGTGTTAAAATATTCAGCTTACAAAAATCTGGCATCACTGGCAGAGAAGAGAGAACAATGGGAGAAATCAATAGATGCATATCTTCAGGCTGTTGCACTTGATGATTCTGACGTGACTGTATGGTATCATCTTGGAGTAGTAGCTCTGAAGACTTTTGATCTTTGCCTGGCTCGACACTCATTTGAAGAGGGTTTGAAGTGTAATTCAAAGCACTGGCCTTGTTTAGACTTACTCTGCACTGTGTTGTATGCTGTTGGGGATTACTACACCTGTCTTGTTATGATTTCAAAGGCGTTGGAGAGAGATGAGGAATATCTTAAAGGCATAGCTTTGAAGAATCAGATCTTTTCTGAGGAGCCTGCACTCAGGAGAGATTCACAACACCTAAGAAACCTATTTATGTGCCATTCAGTAGATGATGAAGAGCAAGAAAATGAAGGAAAAGAGCTTGTGAAGGAAGCCGTTCACCTCAGGGAGGAGAGGTTAAAACTTGTGGAAGCAGACAGGGCTCCTCCTCCTCCTTATCCACCTGTCAAGCCCCTGACATCACACACGTGGGCAAGCCTTGGTGAATGTTTCATTGCTCTCTATGATCACCTCACAGCACCAGAAAATCCCCAGCCACTTGGTCGAAGAGTTGATCTGGAGGGATACTACAAAGCTATTGTCACACCAGACATTTCAATGTCCTACAGAGCTTCTGTTGTTAAAGTGCCTGATTATTCAAGCTCAAGTTTTTCTACTGAAGGATTTTCGGTGTACAAGAATGTGCAAACAGGTGACAGTGATGAAAAGAGCAAAAAAGGACCAAAAAGAAAAAAACCACCTCCAAGTACTATTGAAAATGATTTCCTTCCCAAGAGAAGATCAGCAGGTCTGAATCGTATAATGAATAAGAAGTGGTTTGATATATGCTTGTTGGTCAAAGCGATGGGTATTTTCTTCTTCTTGCATGAAAATGTGAGAACAAACAAAAAGAAGGAGGAGGAAATAAACTACCGGGAATTGGTTCAGTCATTCATTCCCTCACTCTTCAGACCCAGTGTGAGTGCAGATGATGACAGTAGTCAAGATAGTCTTGCAGATGGATCACAGTTTAGTCAGAGAAGTAGCCAGTCACAAACTGCAGAAGGGAAACCTGGAGAAGGGTTTTTCACTGGTGATAGAAATACTTATGATGAAGTAATCACTGGTGAAGCCGAGACACTGGACATTCTCACCTTTGTCAAAGAGCACATGGAAAATGGTGGAATTATTGACTTGATGAATCAGTACGGAATATGCCTTGCAGCTCAAAACAACAAGAAATGGCCTTCTGCCTTGGCAGATGTCTTCCTAAAGGCCTATCAAAGAATGAGAAAGCATGTTATACTTCCATCTGAATTTTGTAATGATGACCAAGACGAATTGTACAGGACAAGAATGGCAAAGCTTGTGCTAGTGGCCAGTGAGCTGACTCTGGACAAACTGCTGACAGCCAAGTCAAAGTCCTCGTCCAGTCTCTCTCCTGCCAGCTCACCACGTGGGGGCGGATCCGGTGTGTCGCCCTTGAGAGTCAGTGGATTTTCCAGTCAATATTTGCCCACAGATATCGAGTATCTTCATCGCATAAGCAGTGATCAGACTATTCATGGAGACTTCACTTTGGAAATGGGCCATCAGAGTGAACTGGATGAGAGCAAGAGTTCAAAGCTTTTGACCCTGAAGGTGAATTCAATCGAGGGACCAACCACTGTCAAGTTAATGAACTGTAAAGTGGACAATCTCGTTACACTTGATCAAGTCCAAAAGAAGCTGGAATCGCTACAAAGGTTCATCGACTGTAGCGAGTCAGGTCATTATGAAGATGTAGTGCAACTTCTGATGCCCACACTCCACCAGCCGCAGCCTAAAACCAAGGTCAGTGAGCTTGGCATGTCCATACCTGAAAGACCGGCTCAGTTGTTATTACTGCAGGACTCGCTTATTAAGCTCAAGGACTATGAGCAATGCATCACGTGTTCCGAGGTTGCTCTGAACGAGGCTGTGTCACAGATGAGTCCATGCGAGGCCTGGTCCACAACTCTCTCCAGGCTCTTTGGTTGTATTGATAGGAGTATTTTGGAATGCAAGAACGTACTGGACAAGATTCCTCAGGATAAACTCAGCAGATTGACTCTCAACATCATCAAGGTTCTTGAGGCTTCCATGTACGCTTCTGAGGGTTCTGATCCGCCGCTAGCAACCGCCAAACCCTGGGTTCTACTCTACAGGATCATCAAACATCAGGAGAAGTACGAGGAGACAGCGGACAAGTCGTCCAAGACATGCGCACCAACTGTTCCTCCACCGACAGACTCTCCAATGCCTGAGACTGCGAACACGGATAGCAATGTGAGCAGCGTCAGCGTTATAAGTGACATACCTGCAAGTAACATTTCACCGTCGCTACAGTTTCTGCGCACTGCGCATGAGCATCTTGGCAGGCGCGGCTGGTGTTGTAATCACGAAGGGGTGTTTTTGTTGCTCAAAGTGGAAGTTCTAACAGAGGAGCTTACAAAAGCAGTCACCGCCGCTAGAGAGGAGCTGGTTCGTGACCTAGAGCAGTGTTTCTTGTGTCTTTATGGACATCCTTCTAAGAAAGCAAAGGCTCGTGGCCTCCTGGAACACAACTCGTCTCCGATTGCCCTGACGTGGAGTAACTCGGTTGTAGTGTTTGATTACTTCAAGCCACCAGAGCCTCCGACATTTGAGAGCAAGTCCAACACCATCTCTGCTGAGGTGCAGAATCTTCTCCGTAGAATTACGGTGGTGATTCCACAGCAAGAACTTCAAGCCATCAGTTTTGAAAGCGTTCAATCGTTTATCGAGGGTGGAGATGAACCGTCCCAAAGCTGCCTGATCGTCTTGTTGGCGTCAAAAGGTGCGCTATCCTCGCTTTGTGCAATTTGTAATTGTCCCAGGATGCCTAAGCCTGTGATCAATGAAATCTTCTACCTGCTTGCTGATTTCTACTTTAAGAACAAAGAATTCAGCAAAGCCCTCAAGTATTACATGCACGATGTGTCTGTTCAGCCCGATAGAGCTGATACCTGGGCAGCTATGGCTCTCGCTCGTAAAAGCAGGCTGGAGAACAAGTTAAACGCGTGTGAACCTAAAAGTGAAGGACCTATACAGAAGCTTGCTGTCTCGGCTCTCAGGTGTTTTAAAAGAGCGCTGGAGATTGACGGATCAAACAGCAGCTTGTGGGAAGAGTATGGGACACTTTGTTATGTGTTATATTCCCATTCATCTAGGCTGCTGAACCAGTTTGATAAAGATGAAATGGCGTCGGACAATCGTACATCGTTGGTACAGCGACGTGACGAGATGTTGCTGTTATCCGAGCGCTGCTTCACTTCGGCTCTTGGAATCGAGGACGGCGAACCCTGGCTACATCACTACATCTTAGGAAAGATCACAGAGAAACTGAAGAAACCTCCGAGTGTCTATCTAGAACACTATCAAAAGAGCGCAAAATATCTAGATGACGACATCTCAGGTTATCCAAGGAGAATTTCGTACTACAGTCCCCCGGACCATTCACTGGAAGCGCTAGAGTTCTCAAAACTTCTGTTTGACAAATTCCCGGATGTAGACGTCAGTGTCCTTGAGGAACATCTGCAGCGAGCCTCGCAAGGACCTTTCTATCATCCTGAGTTTGACACTGACACAGGACAGGGCACTGTCTACAGGAGCGAGTCAACTACATCAGAATCTTTGTCCAGTAGCGTTTTCGAAGACTCCAAACACGGCGAGCCAAGATCTACTGACGTCAAGAGTGGCATCGATTCTGTTAGTGTGGCTGAACCCCCACAGAGTGAGGACTTAAATCTGTCAAATGCAAAGGATAATGTTACAGAAGAACCAAAAGACACTGCCATGGAGGTTTTCTTCAGTGGGAAACTGCGGTGGACTTAA

Transcript

OS493_004324-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y6J0	Calcineurin-binding protein cabin-1 OS=Homo sapiens OX=9606 GN=CABIN1 PE=1 SV=1
O88480	Calcineurin-binding protein cabin-1 OS=Rattus norvegicus OX=10116 GN=Cabin1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002204 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13432 all species →	TPR_16	Tetratricopeptide repeat	Repeat	Interproscan
PF13181 all species →	TPR_8	Tetratricopeptide repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR033053 all species →	Family	Histone transcription regulator 3/CABIN1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15502 all species →	CALCINEURIN-BINDING PROTEIN CABIN 1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006325 all species →	Biological Process	chromatin organization	Interproscan
GO:0031491 all species →	Molecular Function	nucleosome binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17613	CABIN1; calcineurin-binding protein cabin-1	-	Protein phosphatases and associated proteins	ko01009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004324-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

19.8Max TPM

4.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.07	6.94
polyp at pH7 6	18	17	3.87	5.86
coral polyp · control treatment	16	16	6.43	19.83
coral polyp · oil and dispersant treatment	16	16	4.96	15.95
coral polyp · oil treatment	16	16	4.31	9.52
coral polyp · dispersant treatment	16	16	4.65	12.35
Polyp	10	9	1.41	2.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.94
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.70
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.45
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.11
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.99
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.21
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.94
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.54
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.32
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.50
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.33
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.07
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.49
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.86
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.80
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.39
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.36
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.99
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.24
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.16
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.74
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.62
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.38
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.88
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.42
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.23
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.83
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.21
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.09
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.82
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.01
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.22
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.43
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.25
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.35
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.72
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.17
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.05
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.80
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.74
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.70
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.95
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.74
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.08
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.33
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.13
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.36
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.11
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.74
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.66
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.29
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.24
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.09
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.26
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.14
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.11
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.08
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.90
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.51
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.34
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.82
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.01
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.96
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.74
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.69
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.66
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.55
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.29
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.91
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.90
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.51
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.35
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.59
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.90
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.93
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.28
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.48
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.27
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.90
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.06
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.62
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.55
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.08
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.56
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.15
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.85
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.15
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.59
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.59
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.24
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.18
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.16
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.61
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.