Gene detail

Detailed information of OS493_004328-T1 in Lophelia pertusa

Genomic Location: scaffold_8:5130052...5142209
NR annotation: KAJ7387339.1, hypothetical protein OS493_004328 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004328-T1

ATGGGGTCCGTATTTGTCCGAGAGGCAATGGGGAACTGTGAGGGAAGATTATTCCCTGACGGCTCTTGCTGGGACTATTTTTCTCACGATCATGCCCGTTCTCGTGTATACCGCTGGGGAGAAGATGGTCTGTTAGGAATAACTGACAGACAGTGTCGACTGTGTTTTGGTTTGGCTCTATGGAATGAAAAAGATCCAATTCTGAAAGAAAGGCTCTTTGGATTGACTGGAACAGAAGGTAACCATGGTGAAGATGTGAAGGAATGTTACTACTATCTGGACTCTACCCCGACGCATTCTTACATGAAGGCTTTGTACAAATACCCACAGAATGAGTATCCTTATGGTTGGATTGTTAATGAGAATCGAAACAGATCACGACTACAACCTGAATTTGAACTAGCTGACACAGGTGTATTTAACGATAGTCGTTACTGGGATATCACTGCCGAGTATGCAAAGAACACGCCCAATGACATCCTCATCCAAATAACAGTAACAAACCGAGGCCCAGACACTGCGCGACTACACATTTTACCGACACTGTGGTTCAGAAACACCTGGATCTGGGGCTGTAAACATGAAGGATGTACTCGGAAGGCAAGCATGACACAAACTGCTCCAGACACAGTGGAATGCAAACATGAAACCTTGGGAAAGTACACTTTTGTAGTCGATGTGAATCCTGAGAATGAGATGATACCGGAACTGCTTTTCACTGAGAATGAAACAAACACGATGCATCTGCATGGTTCAGCCAACTATACAACATTCACAAAGGATGCCTTTCATCGTCACATCATTCACGGTGAAAAAGATGCAGTAAACGACAAGAAAAAAGGCACAAAAGTGGCTCCCTATTATCTGCTTGTTGTCCCAGCTGACGGGGAACGTGTTCTAAGGTGTCGGATTATGGCTGAGGATGAGATTGTGACAGAGCCGTTTGCTGAAAGGAATTTTGGAGCCATCTTCCAGAAACGACTCAAGGAGGCAAATGAGTTCTATCGTATTGCTATACCATCTGGATTAACTCCAGAGGAAATCGATATTTCTCGTCAGTCATATGCTGGTCTTCTGTGGAGTAAACAGTTCTACCATTACATTATTCAAGACTGGCTGAAAGGCGACCCAGACACGCCACGTCCACCCACAGATAGACGCAAGGGGAGGAACTCTGAAGCGGAGTGGCAACAGCTGTTTAACAAAGATGTTGTCTCCATGCCGGACAAGTGGGAGTACCCCTGGTATGCGACATGGGACTTAGCTTTCCATATGCTCCCGTTCAGCAAAATAGATCCTCATTTTGCCAAAGATCAGTTGCTGTTGTTCCTTCGTGAGTGGTACATGGCTCCTAATGGCCAGCTTCCAGCTTATGAGTTTGCTCTGGGTGATGTGAACCCGCCAGTTCACGCCCTCGCTTGTCTGATGGTCTACAAGATGACGGGCCGTAAAGGAGCAAGGGACGACGAATTTCTGAGTCGATGTTTCCAGAAACTACTCATTAACTTCACATGGTGGGTGAACCGAAAGGATCCATCTGGCAAGAACATTTTTGGTGGTGGTTTTCTTGGACTCGATAACATTGGAATTTTTGATCGGTCGAAGGATTTGCCCATTCATGCGAATCTTTTGCAGGCCGATGGTACGGCATGGATGGCTTTCTATTGTGTGGTAATGTTGAACATCGCTCTGGACCTCGCCATACAAGATGACACCTACGAGGACATGGCCTCTAAGTTCTTTGAGCACTTCACTCAGATTTCAGACGCCATAAATCAAATGTCTGACGGGGTAGGCTTGTGGGACAATGTGGATGGATTCTATTACGACCATCTCAGTACAGAAACGTGTTCTTTGCCATTGCGCGTGCGCAGTATGGTCGGTCTCGTTCCTTTGATGGCGTGTCTTGTGCTGGATGACGAATACATGGACAAACTTCCCGGATTTAGAAAGCGACTCAACTGGTTCATGAAGAACCGGACAGATCTTGCTTCTCAGGTGTCGTACATGGACGCGGATGGCGAGAGTCAATATCATCATCTACTAGCCATTCCCACCAAGGAGCAACTGTTCCGCGTACTTAGTTATGTGTTAGACGAAGAAGAATTCCTGTCTCCTTATGGTATTCGCTCCTTGTCCAAGTTTCACGAGAAGCACCCATTTAGACTGGAACTCGACGGTCACGTTTATAGCGTGCAGTATGTCCCAGGAGAATCGGACACGCACATGTTTGGCGGGAACAGCAACTGGCGGGGACCCATCTGGGTTTGCATGAACTACCTGTTGATTGAAGCCCTCGAACGTTACGACTATTTTCTATGGCGACAAATTCATGATCGAGTGCCCCACCCGGTCGGGGAAACGTTATGCGCCTGCGTGATGTTGCCCTTGAGCTTTGCCGCCGTGTGGTATCGGTGTTTATGCCCAATGAACAGGGACGAAGGCCTTGTCATGGCGATGACGACAGATATGCTTATGACGTGTACTGGAACGATCTAG

Transcript

OS493_004328-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04336	Uncharacterized protein YMR196W OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) OX=559292 GN=YMR196W PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001748 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03200 all species →	Glyco_hydro_63	Glycosyl hydrolase family 63 C-terminal domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004888 all species →	Family	Glycoside hydrolase family 63	Interproscan
IPR008928 all species →	Homologous_superfamily	Six-hairpin glycosidase superfamily	Interproscan
IPR012341 all species →	Homologous_superfamily	Six-hairpin glycosidase-like superfamily	Interproscan
IPR031335 all species →	Domain	Glycosyl hydrolase family 63, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10412 all species →	MANNOSYL-OLIGOSACCHARIDE GLUCOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004573 all species →	Molecular Function	Glc3Man9GlcNAc2 oligosaccharide glucosidase activity	Interproscan
GO:0006487 all species →	Biological Process	protein N-linked glycosylation	Interproscan
GO:0009311 all species →	Biological Process	oligosaccharide metabolic process	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004328-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004328-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

38.0Max TPM

15.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.41	23.74
polyp at pH7 6	18	18	15.04	23.33
coral polyp · control treatment	16	16	19.75	37.98
coral polyp · oil and dispersant treatment	16	16	11.05	23.35
coral polyp · oil treatment	16	16	17.11	29.46
coral polyp · dispersant treatment	16	16	15.85	33.45
Polyp	10	9	7.55	18.26

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.74
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.16
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.52
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.85
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.01
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.39
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.97
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.17
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.91
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.48
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.46
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.54
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.89
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.13
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.02
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.09
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.33
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.09
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.39
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.94
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.84
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.22
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.93
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.25
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.03
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.60
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.29
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.46
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.81
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.72
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.39
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.67
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.98
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.85
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.87
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.07
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.18
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.84
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.17
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.59
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.25
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.76
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.16
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.98
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.28
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.74
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.84
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.67
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.87
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.94
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.09
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.75
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.65
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.86
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.65
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.46
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.59
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.84
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.56
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.65
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.12
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.62
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.97
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.51
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.21
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.93
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.13
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.78
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.65
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.42
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.45
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.50
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.38
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.02
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.20
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.56
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.91
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.87
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.75
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.77
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.69
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.15
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.49
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.43
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.26
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.59
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.43
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.28
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.51
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.43
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.34
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.