Gene detail

Detailed information of OS493_004332-T1 in Lophelia pertusa

Genomic Location: scaffold_8:5177609...5206904
NR annotation: KAJ7387341.1, hypothetical protein OS493_004332 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004332-T1

ATGAGTTTTGCCAATCAAGAGGAAGCTATGGATCAAAGAGAAGCCTTTTTAACTGCTTGGAGGAACTTCTTTCCAAAAGGCAAGCTTCCCGATACAGACTTTTTACAATGTTGTGGTTGTGGTGGCGATTCCGCGTCGAATGAACAAATTTTGGAACGGTTCAATTTGTGCAAGGAAAGGCTCGAGAATGCTATAAGCGTGATAAAAAGCGAGGGATTTGTTCTAAAATGGCTCACAGAGGTTCTAAATGTTAAAGTCTTGGAGCAGAGCGACTCAGAGCTCGACAAAGTTTTAAACTTTTTCTTCCCAAGTGCATTGGATCAATCTTGTACGGATCCGAATGAGCAGGACTCCGTTGCCATACAACCGAATGGCGAAGAAAGATCTGAATTTCACAATTTTAAAGACGTGCCTCTGTCTAAAAGCGAAAACGGTAATTTGTTAAATGCTTGTGACTTGAATGAAGAGCGTAAGACTATTAACACGGAGGCTGAGGCGGGATTTCCTCTTAATGAGCCAGATTTCGCTGTGGACGGAAGTGAACTACATGCAGACATACAGGGGACGTCTGGGGTTAATTCTGGTAAATTATTTAGTAGGGAGAATAATGGATTCGACGGAGAGAAAAGCTCGTTGCACGATGACATTAATATAGCAGAGGGTAATAAACTTTCCGCCAATAACAATACGGAAACGGGAAGTGAAAACGATGTCAGACTAACAAGGACAAATGAGGAGAGAAGCCCCACGGGTTCTTCAGAAGAAGAATACGAAGAAAATATGGAAGACGAATCGCACGAGTTAAATTCTCCTGAACGAGAGAAACCAGCTGGTCTTAAAAATCGAACATTTGCCACTGTTTTCTCGCCTTTGGCCAAGGGAATCAACAAAGCCAAATTGAAAGGAAAGTGGCATTTGGCGCGTTCGACTGGCGCTAAACACAAACGAAGTGACTCACACGAGAGCACGACAAGTGGAGAAGATGTGGATTTCTCGAATCATACGGAAAGTGAAACATTCGAGAATCTCGATAGGGAAGTTTTGTCAGACACTGGTGAAGTTCACAGTGTAAATTCAAACGATATTTGTACGGCAAATCATCAGGATAATATGGCAGCTGACGGCGATGGTTTGTGTTTGGCTCCGAGTTGTCGGATCGAGCGTGATCATGTTGACTTTGCAAGACAGGGAACCTCAGAGAACAATGCCGTGGAAAAGGAAGACACAAACTCTCAGGAAGACAGGTGTGAAGCGACAATCGAAGAATCACCCGATGTCATTATCGAAGTTGTAGATGAACTTATCTCCTACTTGGAAGGAATCGAAGTAGTGAGTAGTGATGAGCTCGAAGGGGAATCGCCCCACATTTCCGAGGGAGATGATTTTATGTTATTTGGTGGGGTTATAAGGCCGCGAAAGCCCCTACGGTCTCGAAAACAACTCGATTCAGTACTCTCTTTGGGCAATGTGAGCTTGATGAGCGCAGACTCTTGTGTCAGTCCATGGTCTATAGATGTAGCTGCTTGCGAGATGCAGTCAGCTGATTCATCAGAACAAGAAGACAATGCATCTTGTGATTACAGTGAGGCGCGACCTAGTGTGGAAGCTTCCCCTTCTCTCCCGAATGCGGAATCAACCAAGCAGCCAGCAGGGCAGGGTACTGGTACCCCACCCCCGATCAGGCCGCCTCGGCGTAGTAAAACTGAGAGACGGTCACGCACAGTAGGATCACCAATGAAACTAGGCGCTATTAGCACAGATGATGATGAGGTCTTTGGAAAAGACGATAAGGGATACGAAGGGGATTACGAGACCCTCACTCGTTCATCGCAACTTACCTCCCGTTTGCCAAAGAGGAGTGCAAGTGATGCTGTTCGCCCTCGAAGCCAAAATGCAGATAATGACGATCACCGGAAACTACGCAAGGCCAGAGGCTCTCATGTTGTGATTGGCGATGATAATGTTGATTTCCCGTCATCTCCTGTGCCTTCCCCTAGTGGAAGTCCTGCAAAACATGCAGATCCCAGTAGTGAAGGTAAAGCCGAGAAACTGCACAAGAGGAAGTGGGTTGTCGCTGCTGTGTTGGATGGTGAAAAGGGATACCTGGAATGCCTCAACATGTTATACAAACACATGAAGCCTCTGAAGTTGTCTATTGAATCATCAGCCCCAATCTTGACATCTGTGGACTACAATAAGATCTTTCACAAGCTGGACGAACTTCACACAATCCACACTGTGTTCTATAATGACCTGGAGGCACGTGTGGATCAGTTTGATGTCTACAGAGAATACATATTAAACTACAAAACTGCTTTATCAACGATACGCAAATGCAAAACAAGCAATGAGCAGTTCAACAACATCTTTTCAAAGGAACTTAATGTGCATTCTATTCAAGAAGTGACAACTCTAGAAGGTCTTTTCAGTAAGCCAGTGGAACGAGTGGGCAGATATATAGTTTGTCTAGGGGACTTGATCAAGCAAACACCAGATGATCACGCAGATTATGAACTTTTAACAAATGTGTTGAACTCAACGAAAGAGTTCCTTGCAAGAATCAGTGGCGATGACAGAGATGGCGGGAGTATGCCTCGAGTGAAGCGAGATCACAGACTAATTAAAGATGGATTCATTGTCGAACTTGCAGATGGAGTTCGTAAATTTAGGCACCTATTCTTGTTCAATGACTACATCCTTTGTACAAAGAGAAAGATAACTGCCAGGAGTGAACAGTACGTGTGCAAGTGGTATGTTTCTCTGCATGAGATACAGTTTCATCCTACAGAGAGCTCAGAAGCGGCACAAGTTATTCCAGTGACGAGCAAAGTTGATTTTGATTTACTGAAGAGCAAGATTGCGAGTACAAAAGCCGAGATACGACGAGAAGAAGGGGTCAGCGGTTTCAACAGCCCAGACTCCTCGCCTTCAAGCAAGCGACGTCGAGCACAGTCTGCTTCCAAGATTGTAGAAAAGATGAAAAAGCGTCTAGCCGAGCAGGAAGCTGCTCTGTTGTTAGCCGTTCCCTGTCTGCCTCTGACGGTGTACCACAAACAAGGAAAGACCTATACATTGCTTTGTAAAACTGGCGGTGAACGAGCTGACTGGAAGGAGGCAATAATTCCTCTTTTAGAAGAAAAATCAGATAATCCAACAGCCGACGGCCAGCTTAGTATGATCGAACTACACCATTTATTGGAGGCATGCAAGAAGTTGAGAACATGCAGGTCGCTGGGTAAAGTTTCTATGAAGGAAGACAAAAGTCTCCTGAATGGTCTACTCTACGTTCATATCCATTCTGGCCGAGGATTTCACAAAAACGATCTCAGTTGCGTGGTTGAAATTGATCATTATGGTCAGTTTGTCCGGAAAGCCAAGACAAGAACATGTAAAGCCTCTACTGAACCTGTATGGGACCAGGACTTTGATGTCGAGGTGGAAGGAACAAGAGAACTCAAGCTTCACGTGTATTGCAAGAGCAGACTTAACAGGGACGAGCATTGTGCGCAGGGAAAAATAGAGCTCCTGAAGGAAGACTTGAAGGATCTAAAGAAACGGACCATCACAATTACCTTGGATAAACAGGGTGCCGTCACGCTATCGCTGCAGTACTCTAAGACCCCTCAAGGAATTCAGAGAAAGAAATCGTTAAGTGAGAAGGGAGTTTTCGGAGTTGATATCGCGACAGTCTCAAGGCGAGAGGAAAGCGATATTCCTTTGGTTGTCATCGGATGTGTGCAAGAAATCGAAAGAAGAGGGATGGAGGAAGTAGGAATTTATCGTTTATCAGGAGCAACTTCTGAAGTTCGTAGACTGAAAGAAGCCTTTGACAACAACAGTCAAAGTGCTCTGGTGCAAGTGGCCGAGGCGGACATCCATGCCGTTGCAGGACTTCTTAAGATGTACCTCAGGGACCTTCCAGAGCCTGTCTTTACGGACGACCTATATCCCAAGTTCGTCGAGGCAAACGGCATCAAAGATCCAGAAGAAAAGAAGAAAGCGATGATGGAGCTGTTTGAATCGTTACCCACACCAAACAGGCTCACCTGCATCTATCTACTCGATCACCTCAGAAGATTAAGCGAGCATCAAGAACAGAACAAAATGGGTCAAAATAACCTGGCGACCGTATTTGGCCCGAACATTCTTCGTCCATCGTCGAGCGCCACCGACCCGACCGACCTCGCTAGAGGCACGCTCGATGTCATGAACCAAGTGGGAATTTTCCTGTGGTTCATCAAATTTAGTTCTCATCAGCTCCCCGCGGATCCAGAGCTCATGCATAGACTGGACCCGAGAAAAGGCACGGACGCTGCCCCCGCGCCAGATCGTCAAGACAGGCTCATATGA

Transcript

OS493_004332-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6PAJ1	Breakpoint cluster region protein OS=Mus musculus OX=10090 GN=Bcr PE=1 SV=3
F1LXF1	Breakpoint cluster region protein OS=Rattus norvegicus OX=10116 GN=Bcr PE=1 SV=4
A6QNS3	Active breakpoint cluster region-related protein OS=Bos taurus OX=9913 GN=ABR PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003646 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00621 all species →	RhoGEF	RhoGEF domain	Domain	Interproscan
PF19057 all species →	PH_19	PH domain	Domain	Interproscan
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan
PF00168 all species →	C2	C2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR000219 all species →	Domain	Dbl homology (DH) domain	Interproscan
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR035899 all species →	Homologous_superfamily	Dbl homology (DH) domain superfamily	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR037769 all species →	Family	Abr/Bcr	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23182 all species →	BREAKPOINT CLUSTER REGION PROTEIN BCR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0043547 all species →	Biological Process	positive regulation of GTPase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004332-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004332-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

81.2Max TPM

17.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.28	16.86
polyp at pH7 6	18	18	8.64	12.25
coral polyp · control treatment	16	16	14.99	27.00
coral polyp · oil and dispersant treatment	16	16	23.75	61.91
coral polyp · oil treatment	16	16	12.17	17.65
coral polyp · dispersant treatment	16	16	44.46	81.22
Polyp	10	10	3.74	7.05

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.86
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.87
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.86
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.78
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.37
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.30
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.42
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.94
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.69
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.14
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.37
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.33
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.29
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.23
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.74
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.46
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.76
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.67
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.25
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.83
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.82
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.35
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.71
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.03
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.82
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.50
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.93
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.10
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.05
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.54
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.53
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.52
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.66
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.49
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.58
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.33
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.78
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.42
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.98
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.74
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.74
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.56
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.36
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.71
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.99
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.28
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.88
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	61.91
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.23
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.96
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.79
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.04
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.22
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.59
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.19
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.81
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.65
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.54
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.56
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.37
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.32
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.62
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.65
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.62
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.51
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.13
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.10
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.90
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.73
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.44
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.39
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.15
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.27
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.18
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.64
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.28
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.08
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	81.22
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	80.92
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	79.22
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.64
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.35
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.27
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.77
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.47
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.59
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.85
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.36
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.22
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.70
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.89
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.58
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.05
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.79
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.78
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.46
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.71
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.16
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.71
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.04

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.