Gene detail

Detailed information of OS493_004340-T1 in Lophelia pertusa

Genomic Location: scaffold_8:5307777...5317536
NR annotation: KAJ7387349.1, hypothetical protein OS493_004340 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004340-T1

ATGGATTACAGAGCTACCCCAAAAGGAAATTTGGACGTTAAATCGGTCACAAAACGCCGTCGCCGGTCCGTGGCTGAAATACGGTTGCTTCGTGACGTTGACGAGAACGCCAGCCTGCACAATGAAAGGAGGAACAACTCTGAGCTACACAAGTTATGGGAGTATTTCACAAACGGGTCTTCGTCACTCTTGTCCATCCGAAATTATTTTAACGCGTATTTCACAAAGACGAAGCCAGATAACAATGCAATAACCGATTCTACAGCTTCGTTCAAGATATGGCGACGGAAGAAACATTCCCAATCATCAATGGTTCAGTGTAAGAAACAGACCGAAGAACACAAGCGATTGGAAGTTGACAAGAATGACCTCAACAAGAGATGGAAAGAATGGGGACCTTATTTGTCCGAGAGGCAATGGGGAACAGTACGTGAGGATTATTCTAGCGATGGAAACTGCTGGGACTATTTTCCTCACGACCACGCCCGATCACGTGCTTATCGGTGGGGAGAGGACGGTTTGCTAGGAATCACGGACCGGGAGTGTCGGCTGTGTTTTGGTTTGGCTTTGTGGAATGAGAAAGATCCCATTCTGAAAGAGAGGCTCTTTGGACTCACTGGAAACGAGGGTAACCATGGTGAAGATGTGAAGGAATGTTACTACTATCTGGACTCCACTCCAACGCATTCTTACATGAAGGCTTTGTACAAATACCCACAGAATGAGTATCCTTATGAGCGACTTGTCAGCGAGAATGGAAAAAGAACCAAGCAGGAACAAGAGTTTGAACTCACTGACGCTGGCGTATTTGAAGAGGGACGCTATTGGGACATTTTCACAGAGTACTCCAAGAACACTCCCAATGATGTGCTTATCAAAATTACCGTTGCAAACCGCGGACCAGAAACAGCGCGGGTGCACGTGTTGCCGACCTTGTGGTTCAGGAACACGTGGAGCTGGGGCTGTGATCACGAGGCGTGCACGTGCGGATCAAACCCGGAAGGATGCATGAGGAAGCCAAAGCTGATGCAGACAGCACCCGGTGTTGTGGAATGTCATCACGGCATGGATTCTAACCAGGAAGGACTAACACCAGAACTAGTTTTCACAGAAAACGAAACAAATTTCAAGAAACTCTACAACATAGCTAACGCCTCACCGTACACAAAAGATGCATTTCATCGCTACATCATCGAAGGAAAAACCAATGCTGTTAATCCACTTCAAAGGGGCACCAAGGTGGCAGCGCATTACGTCCTTACGGTCCCCTCTGGGGGACAGCATATAATTCGTTGCCGCCTCTCAGTCTGGGATGATAGAGTGCCTCTGCCATTCAATGAGAAGGCTTTTGATGAAGTGGTCACCCGGAGAAAACACGAAGCTAATGAATTTTACAAAACTGTTATTCCCGAATCCCTTTCAGATGACGAAGTGATAGTCTCGCGCCAGGCCTACGCGGGATTGCTGTGGAGCAAACAGTTTTATTATTACGTCATTAGTGAGTGGCTTAAGGGTGATCCCGGCATGCCTTGCCCGCCTGGTGATCGTTTGAAGGGACGGAACTCGGAATGGAAATACTTGCATAACAAAGATGTGATATCCATGCCTGATAAATGGGAGTACCCATGGTACGCCTCATGGGACTTAGCTTTCCACATGCTTCCCTTCTGCAAAGTCGACCCTGAGTTTGCCAAAGACCAGTTGTTACTGTTCCTCCGCGAGACTTACATGGCGCCAAATGGACAGATTCCCGCGTATGAGTTCGCGCTCAGTGACGTCAATCCGCCCGTGCACGCGCTGGCCTGTTACCGAGTGTACGAGCTGACCGGGAGGTCTGGAGAGAAGGACACTGTCTTCCTTGCGAAATGCTTCCAGAAACTTCTTCTCAACTTTACTTGGTGGGTTAATAGAAAGGACCCTGAAGGGAAGAACATTTTTGGAGGAGGTTTTCTTGGCCTTGACAACATTGGGTTATTTGACAGATCCAAGCCTCTTCCCCCTGGAGACCGCCTTTGCCAGGCGGACGGCACAGCATGGATGGCGTTGTATTCTGTTGTGATGCTTAACATCTCCTTAGAGCTCGCTCTCAATGACGCCGCCTATGAAGACATGGCTGCCAAATTCCTGGAACATTTCACCAGCATTGCAGACGCCATAAATCAAATGTCGGATGGGTTCGGACTCTGGGATCCGCAGGATGGATTCTATTACGATCATTTCCACAGGGGAGACGAGTTCTTTCCTCTGCGCGTGCGTAGCATGGTTGGCCTGGTTCCTCTGCTGGCCTGTTGGGTGTTGGATGGAAGTACCTGGGTAAACTACCCGGATTCAGAAGCCGGTTAA

Transcript

OS493_004340-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04336	Uncharacterized protein YMR196W OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) OX=559292 GN=YMR196W PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001748 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_004340-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR012341 all species →	Homologous_superfamily	Six-hairpin glycosidase-like superfamily	Interproscan
IPR004888 all species →	Family	Glycoside hydrolase family 63	Interproscan
IPR008928 all species →	Homologous_superfamily	Six-hairpin glycosidase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10412 all species →	MANNOSYL-OLIGOSACCHARIDE GLUCOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004573 all species →	Molecular Function	Glc3Man9GlcNAc2 oligosaccharide glucosidase activity	Interproscan
GO:0006487 all species →	Biological Process	protein N-linked glycosylation	Interproscan
GO:0009311 all species →	Biological Process	oligosaccharide metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17108	GBA2; non-lysosomal glucosylceramidase	EC:3.2.1.45	Other glycan degradation	ko00511	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004340-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

72TPM > 0

7Conditions

21.9Max TPM

1.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	7	1.34	5.97
polyp at pH7 6	18	8	2.35	10.89
coral polyp · control treatment	16	12	0.85	3.67
coral polyp · oil and dispersant treatment	16	15	4.41	21.91
coral polyp · oil treatment	16	15	0.84	2.57
coral polyp · dispersant treatment	16	15	1.32	3.98
Polyp	10	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.97
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.08
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.76
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.56
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.14
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.89
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.70
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.33
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.05
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.73
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.61
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.87
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.67
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.55
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.36
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.31
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.75
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.55
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.25
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.17
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.15
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.11
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.91
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.67
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.68
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.97
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.54
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.83
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.79
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.82
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.78
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.58
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.38
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.22
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.57
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.47
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.51
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.72
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.60
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.59
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.58
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.55
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.54
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.38
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.32
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.18
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.12
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.98
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.43
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.71
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.67
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.01
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.96
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.65
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.42
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.11
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.01
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.