Gene detail

Detailed information of OS493_004351-T1 in Lophelia pertusa

Genomic Location: scaffold_8:5482964...5504730
NR annotation: KAJ7387360.1, hypothetical protein OS493_004351 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004351-T1

ATGTCGTTGACCTGTCACATCTTGATATTAACCTTATTCTTGAGATGTTGCTGTGTGGAGGGCTTTCTTCGAGGGATGCTGTACCCCAGGGAATCGGAGACTCGGCAAGTGAAATCTTTAGACGGGATGTGGGATTTCCGCGCGGATATTTCGTCAGCCGGATTTGAAGAGATGTGGTACTCGCTGCCATTAGCACAGATTGGCGATGTTCTGTCGATGCCTGTTCCCTCCAGCTATAATGACATCACTGAAGAACGCTGGCTCAGGGACTTGTTTGGCTGGGTCTGGTCGAGAAGTGTATATTATCGCTGCAAAGTGTGGTTAAACAATAAAGCGATATTAGAGCACGAAGGAGGGGACCTGCCGTTTGAAGTTGATATTACACGCGAACTAAATATCATTGAAAGAGACACGCACAGGCTGACAGTGGCTGTGAATAATACTCTGACAATACCAGGAGATGTGGAGACTCATAACAGTTCACGCTTCTGCGATTCATCCAGTGATCAGGTCACAGAAATCGACTTTGCAGGAATCCATGGCTCAGTAAAACTCTGCACAACTCCCCAAGTGCATTTATCTGACATCACTGTTTTCACGGAACATACCTACACCAAAGCTACGCTCAAATTCGTAACGGAAGTCGGAGCAAACAATGACGTCAAATCGAATGACATCATTATGAGCTACGAATTGCGCGACAGAGCGGGGAGGGTGGTTGCTTCTGGAGGAGGAGAAAAGATGTTCAGTGGGGAGATGACAGTATTTTTCCCCACCCTGTGGTGGCCGATTGGTATGAGTGACACGCCAGGCTATCTTTATACACTAAAGGTTATCACGTCATATAAGGGTATTCATGATGTGTACACCCTTCCAGTGGGCTTCAGGACCGTCCGTGTGGAGGGCTCCAGGTTCCTCATCAATAACGTTCCTTTCTACTTCAAGGGTTTTGGTAAACGACAGGATAGTGACATTCGAGGTCGAGGCTTTGATTACGTCACATTGACAAGAGACTTCAATCTGATCAACTGGTTTGGCGCCAATTCCATACGCACAAGTAAACACCCACCTCCCGAGGAGCTTCTAGAACTCACAGACAAGTATGGTATCGTGGTTATCGACGAGAGCCCAGCATTAGGACCAAAGGAAGTGTTCCAGAACTACATATCAGAACACGCAGGAAACCGCCACCTTGATTTGCTGTCAGAACTCTTACAACGGGACAAGAACCACCCATCTGTGGTGATGTGGTCTGTAGCCAGTCATTCAGCCACGGCGCACAGCAGAAATATTGACTCACACCTGAGACGAATGATGGACTTTACTCGTGAGATAGACGTACAGAAACGTCCTGTTACTTATGTCACGTCTTCCAGTGATAGGATAATGGTAGTGGAGGACCCTGCGCTTGAATTTTGTGACGTCATTTCATTCAATCGTCACTATGGTTGGTATTGGTACCCAGGCCAACCCGACTTGATAGCGAAGTCGTTAGAGGAGGATCTGCGTGGCTTACATAACGTGTTTGGTAAACCAGTCCTAATGGCCGAATATGGCACCAGTGCTGTAGCCGGGAGGCATAAGAAACCATCGATGCTTTATACAGAAGAGTATCAGGTAGATACAATGAAACAATATTTTCCTGTGTTTGATCGACTCAGAAAAGAGTTCTTAACAGGAGAAATGATCTGGACCTTTACAGACTACAATGTTCTACAATCTTATGATGTCATGTCAGCTAACACAAAGGGACTCTTGACTCGTCAAAGACAACCGAAGGCTTCTGCGCATGCTCTACGGCAGAGATACCAAGCCTTGGCCATGGATGCGCATCCCAGGTTCACTGGTGACCAGTTACTGGATGCCCTTATAAGGTTTAAACCTCAGGGTGGTGACCAGTCCCCCATCACTGTTGAGCACCGATTGCCTGCTTTGATACGAGAGGAAAGAGTTAACACTACAATACGAAAACGCTCCGTGGACGAAATAATGACATTCTACGAGCCGTAA

Transcript

OS493_004351-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P12265	Beta-glucuronidase OS=Mus musculus OX=10090 GN=Gusb PE=1 SV=2
P06760	Beta-glucuronidase OS=Rattus norvegicus OX=10116 GN=Gusb PE=1 SV=1
O77695	Beta-glucuronidase (Fragment) OS=Chlorocebus aethiops OX=9534 GN=GUSB PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001408 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00703 all species →	Glyco_hydro_2	Glycosyl hydrolases family 2	Domain	Interproscan
PF02836 all species →	Glyco_hydro_2_C	Glycosyl hydrolases family 2, TIM barrel domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan
IPR006101 all species →	Family	Glycoside hydrolase, family 2	Interproscan
IPR036156 all species →	Homologous_superfamily	Beta-Galactosidase/glucuronidase domain superfamily	Interproscan
IPR006102 all species →	Domain	Glycoside hydrolase, family 2, immunoglobulin-like beta-sandwich	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR006103 all species →	Domain	Glycoside hydrolase family 2, catalytic domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10066 all species →	BETA-GLUCURONIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004566 all species →	Molecular Function	beta-glucuronidase activity	Interproscan
GO:0019391 all species →	Biological Process	obsolete glucuronoside catabolic process	Interproscan
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01195	uidA, GUSB; beta-glucuronidase	EC:3.2.1.31	Lysosome	ko04142	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004351-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

143.8Max TPM

4.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.73	9.05
polyp at pH7 6	18	18	2.77	8.32
coral polyp · control treatment	16	16	10.24	132.64
coral polyp · oil and dispersant treatment	16	15	10.34	143.77
coral polyp · oil treatment	16	16	2.16	4.49
coral polyp · dispersant treatment	16	16	1.62	3.51
Polyp	10	9	1.88	4.41

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.05
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.35
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.06
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.93
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.36
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.15
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.34
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.18
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.95
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.88
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.22
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.81
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.67
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.59
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.55
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.11
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.32
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.08
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.83
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.66
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.61
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.52
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.39
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.31
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.25
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.52
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.29
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.27
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.24
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.09
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.83
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	132.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.85
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.79
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.45
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.86
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.28
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.25
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.24
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.21
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.77
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.71
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.32
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.11
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.43
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	143.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.69
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.74
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.15
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.60
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.59
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.46
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.17
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.04
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.04
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.03
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.60
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.17
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.49
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.31
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.69
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.55
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.18
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.14
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.88
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.52
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.99
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.68
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.68
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.25
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.51
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.77
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.35
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.27
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.04
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.95
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.89
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.78
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.55
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.25
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.41
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.85
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.10
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.97
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.94
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.51
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.15
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.88
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.