Gene detail

Detailed information of OS493_004397-T1 in Lophelia pertusa

Genomic Location: scaffold_8:6044395...6062398
NR annotation: KAJ7387403.1, putative E3 ubiquitin-protein ligase HTD4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004397-T1

ATGAGCGCCAAGAACTGCCAGGAGGTGACCTTACCCCCCTGCGCCAGGCATTACTTAGGGGTGAATCAGGAGGGGAGCTCCGTGTTTAGAGTGGCTAAACTGCTGCTTGCCAAGCTAGGCGACTTTGTACTGCCCTCTGTGGACTCGGCAAGTGATGAGGATCTGGAAGATGATACAGAGGAGTATGACGAGAATGAGATCACTGATAAAACTGGCAGCAGCATGATGTGTTTGTATTTGCACAAACGAGATGACCAGCCAGCCCATGAAGTTGTTCAGAAAGTACTGAGTACGGACGGTACACCATTCATCTTTCGCGTGGGGCAAGGCTCCGAGATGGAGCGCGCGATCAAACTCGACCGAGAGCTGACTGAGTACGGACGGGGGGTACTTCTTACCGACTCGTTATCTGTATGCCTTAAAAAGGCGACATACTGGGCCCAGGCAGGACTGGTGGTCAGTGTGGGACCTTTTGGCCTGCTGGATGGGGATGGAGATAGAGGGAAGTCAGCTGAGGGATCGGGAGACCCGGAGAGCGTGTGTAAAGCACGCAACAGCCGTCTGTCCAGAACTGAACGTAGCCGTCCTTTCATAAGCGGCCAAGTGGCGCACACCATGGCTTCAGAAGTGATCTCTTTGTTACATGGCTTACTGGTGTCCTCCGCTTCCGAGATCGCTAAGATATGGGCCTCTGCCGTGCGAGATGTGCTCTGCGAGGCGCTGGATTATGTACCTGACCTGATGAGGACCCTGGAAGTGGAAGGGAGGGTCTTGTTGGGAGGGGACCAGACAGCCACCGAGGAACAGGAGCCTAAAGAAGATGGGCAGTTTTCTAATGAACACGAGTGGTTTTTCAAGGCTAGGAACGTTATGGCTTCTCTGTGTGCTTTGGGTGGTTTTTGTGAGAGCGTTCACTCTGGATGCACAGTTCAGATTTGTGGAGAAGACATGGTCCGTACAACTGGTGAAGTGGTCAGTGTGTCTGACAGACAGGGCATAGCCACAGTGTTACTGGACAATGGAGGGGAGACGTACAGCGACAGGGTGCAGGAGATACCACTGGCACGGCTTAAAGTTGCTAACACTAAGGTGGTGTTTCTTAGCGACTTGTCAATGGGTGAACAAGCTGTTGCTGCTTTGCTTTCCATTTTAACTTCAAAAGAAACATTAATTGATCAGCCTTCCGAGGTGGACCTGAGTGAAAACATTATTTCACCATCACCGGCAGCACGAATACTGGCAGAAATAAAAACTAGAGCAAGTATGGTGTTATCTTGTCAAGTGCAGGACTCCTCTTTTGGCGATGCCATTTTAACAAATCCATCAGTCGAACTCATCTCCAAACTAGCAGCCGAGTGCAATCCAGGCCTGAGACTACCCGTGGTAGAGATCCACTGCCAACAGTTACGGAAACTCTTCAAAGACTTTGTCAAACCTGCTGAGTTGCCCAAGAAAGTAATCCAGAGCGGCAAAAAGATGGTGCTTGATGGGAGCCGGGCATTCCCTCCCGTACGGGGATGTGTTTTTACCGAGGGGCACACATGCGTTCACTTCATGGCCGACCCTGCGGCAGGCTTCGGACTTCCCAGGGGGACGTTTGTGTATGCTAACGCTCCATTGCCTCAAAAGGCACCGTCGTTTTACTGGGAAGTGGAGCTTTGTTCCCTGGGGGACACGGGACAGCAGGACCCGGGTCCTTGTATTTCCGTGGGGTTTTCTCCATGGACAGATCAGCTTGCCAGCGGTTGGATCAATCCTGTAGGCTCATGCCTCCTGCACAGCAATGGCCGTGCGGTGTTGTACAGAACTGGCGGGCTTCTGCAGTGGAAAACTGTCTCGCTAAATATGGTCATGAAAGAGAATGACGTCATTGGGTGTGGCTACAAGAGAGCTGAGGATCACTCTGATAAAGGGTTGGCTTATTTCACCTGCAATGGTGAACGACTAGCGGAGAGCCTGGATGGCGTTCAATCTGGTCTGTGGCCAGTTATTCACATACAAAAGAAGAACGTGCGTGTTCGAGTGAATTTTGGTGCTCGCTCGTTTCTGTACGCAGAGGGCTCCAAACACCGTGTGGCAGCGGACATGTGGAGTGACTCTTTGGAGGATCTCAGGCAGGGATTCAGCGAATTGCCCTTTGCCCTCGAACCCGATAAGGAGGAGGGGATGGATGGACAAACACTCTCTAAAGTGGCTAAACCCTCGCCGACTAAACCCGCACCTCTTACCATCCCAAAAGATGCAGGAAAAGAATACGACCCAATGTCCTGTCTTCAGTACAAGCTGACGAGTAGCTACGACAGGATGACGGACGTGGGCCCTGCAGCACCTCTCCGTGTGACTGAAGAAGGCGCCAGCCGGGGCAGAGAAGCCACACCGGTGGACCCCGCGCGTCTGTTGGTGAAAGCCTGGGAGGACAAAGTGTTTCCCGTCATCAGAAGGCGGTTCCGTTCAAATACTGATCGGCAGTCTGGACTGGAGCAGATCAGGGGGGCACTGCTTGCAGGTATGATAGACATCGCAATCTCCACAGTAGCTGATTTGTACGAGGACAACGGTGGTATCCCGGCAAGCCTGCAGTTTCCTAAGCTTGATGACGTCAAAGCTGACGTCAATAAAGTGAGCGCGGGAGGCCTGAGACCGGGTGAAGCGGTAATCATCAAGAGCTCCACTCTCGCCTCTCTGCCCGGCTTTGCAGTCCCGGATATGAAAAAAACGTTTGGACTCACAGGGGTGGTGAAGAGCGTTGACAAGGTGTGGTATTTGTTAACGGAGCCATGCCAATTTTCGCAATGCACAGAATTACAGTCAAACCTCTATTAA

Transcript

OS493_004397-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y4D8	Probable E3 ubiquitin-protein ligase HECTD4 OS=Homo sapiens OX=9606 GN=HECTD4 PE=1 SV=5

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006153 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_004397-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR043366 all species →	Family	HECTD4	Interproscan
IPR043136 all species →	Homologous_superfamily	B30.2/SPRY domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46435 all species →	E3 UBIQUITIN-PROTEIN LIGASE HECTD4-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0042593 all species →	Biological Process	glucose homeostasis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004397-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004397-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

15.6Max TPM

5.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.03	10.10
polyp at pH7 6	18	17	5.53	9.26
coral polyp · control treatment	16	16	7.64	15.59
coral polyp · oil and dispersant treatment	16	16	5.52	11.00
coral polyp · oil treatment	16	16	5.79	10.34
coral polyp · dispersant treatment	16	16	6.44	13.45
Polyp	10	9	1.15	2.61

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.05
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.76
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.26
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.10
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.22
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.11
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.08
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.05
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.45
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.02
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.75
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.68
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.57
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.76
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.26
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.04
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.57
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.17
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.76
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.95
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.73
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.28
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.59
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.78
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.60
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.13
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.99
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.26
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.56
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.75
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.18
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.93
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.00
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.26
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.88
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.39
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.69
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.66
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.45
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.42
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.80
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.56
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.29
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.89
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.85
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.08
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.42
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.77
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.40
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.06
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.59
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.54
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.81
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.53
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.95
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.80
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.27
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.75
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.63
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.40
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.78
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.24
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.11
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.35
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.32
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.41
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.96
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.89
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.24
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.87
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.03
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.61
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.94
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.83
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.35
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.03
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.66
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.52
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.51
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.