Gene detail

Detailed information of OS493_004402-T1 in Lophelia pertusa

Genomic Location: scaffold_8:6121014...6144043
NR annotation: KAJ7387408.1, ATPase morc2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004402-T1

ATGAAGCTATGCACAATAACTAACTACTTTGCCTCGTTTGCAGCGGAAGTTGCGAATGTGGTCCAGTTTGGACGATCGGTCAAGCGTACCGTGGACTCAAGAATGATTGGACAGTATGGCAACGGGCTGAAGTCAGGCACGATGCGAATAGGGAAAGACATGATACTGTTTACGAAAAAGGGTAACACCATGAGCTGCTTGTTCCTTTCGAGAACATTCCATGAACGCGAGAAGATTGAGGAAGTTGTAGTTCCAATGCCTTCCTGGGATTCATCCACCAACAAACCTTTGGCGAGATCCAAGCGTGAATTGGATAAACACCAAATTGAGACGAACTTGATCTTGAAGTACTCGCCATTCAAGACGGAATTACAGTTGTTTGAGCAATTTAATAAAATTGGATCGAAAGGGACACTTGTTGTTGTGTATAATTTAAAGCTCATGGACAACGGCGAACCAGAATTAGATGTAGTCAGTGACCCACACGATATCAAAATGGCGATCGAGGCTGACGCTGGAGCCAAAGAGGCTGATTACGACATGGTGATGCCTGAGCGGAGTTCCTTCAGGGCCTACAGTGCTATTTTGTACTTGGACCCTCGAATGAAAATTTACATCCAGAACAAGAAGGTCCAGACCAAGAAATTGATCGCTACCTTATACAAGCAAAGGTGTTACCACTTCACGTCCAAACGGTTTAAGACAAGATCGGAGCAGGAGAGTGAGAAGGCAGACCGTGAGGCTAAAATAGCTGAGGAGAAAGCAAGAGAGCTTGAAACACAAGCGAGGGAACTCCAGAAGCTGGCAGAGCAGACTTCGAAAGATAAAAGGGTGGAGCTGAGAAAGGCACAAGGTCTTGCTTCAGAAGCCCGGGGACAGGCACAAATGAAGACCAAGATTGCAGATGCTAAGAAGAAGTCAATGAAGGAACCGAAAACACTCAACTTTACATTTGGATTTAATATTGAAAATCGTTCGTGCTATGGCATGTTCATCTACAACTGCAGTCGGTTAATAAGGATGTACGAAAAAGTTGGACCACAGAAAGATGGAGGAATGAAATGTTACGGGGTCATAGGCGTTGTAGATGTGCCATACCTCGTACTGGAACCCACTCACAACAAGCAAGATTTTGCAGACGCAAAGGAATTCCGGCACTTGAAGATAGCGTTAGGGGATCACCTTGAACAGTACTGGAAAGACTCGCCAATTAAAAATGTGAATAAGTTCTGGGAGGATTTCGGCTACGTAGGCAGTAGATGGACAGACGGCCCGTCCATGGATCAGAAGTTTGTGAGGAAAAGAGCAATGCAGATAACCTTAAATGTACAATGTGACGTGTGCCTCAAGTGGCGTTCGTTGCCGTTTTCGCAGAAAAATGTCGGTCGTGAATTGCCCGACGATTGGTGCTGTGCCATGCATCCGGACCCGACTTGCAGAAGTTGTGGTCGCGCCGAGCAGAACGTTTCATATTCTATAGGAACTCTACAGAGACAAGTTAAAACTGCTGAGGAGAAGCAGAAACAGCTGGAGGAGGATATCCGAAAGAAGAAGGAACAGCTCGATCAAATAGAGCGTCAACGACCACCACCACCAACGGTCCCACAAAAAGAGGAAAGGCCTAAAATCTCACAAAAAGAAGAAAAAGCTAGAGTTGAAAGGACCTCGTCAGCGGGGAGTTCAAGCTCTTCCAAGAGTGACAGCTCAGAGAAGCGGTTACCGAAGAGACCAGTGGCGGACAGTACAGAGGGCGAGAGGAGAAAGTCAAAACCTACGAACGAGCCACTGAAACGACGAAATGCAGAATCACAGCCTGCTGTTGAGGCTGTACAGGCTAAACGGAAGAAGAATGACGCCCCAGCAGCGAAGACCGTCGCCAGGAAAGAAAATCAGGAACAACGAGAACAGCAAACGAAAAGACGAGCAGAACCGAGGCAGGAAGAACCGAAACAAGAAGAACCGAGACAAACGGAACAGACATCAGAGGGACAAACACAAGATGAACAACAACGCAAGAAAGAACAAACGGAGCAAGAACAACTCGAGATGGAACAGCTCATGGAATGGAGCAGTGAGGGAGAAAGTGATGCAACAACACTTCCCAAGGGAACCAAGGTGGAAGCGCGGGTTGATAATTCTAAATGGTACCTTGGAAAAGTGATGGCTGTAAAACCAAAGAAGGGGTCTGCGTGCAGGGTCCGTGTCAAGTTTGATATGTACCCTAAGGACAAGTATGACAAGTGGTTTGACCATCCCGGTGAGGATTTGCGAGTTCTGCAACCTGTAGAAGAAGCACCAGTTCCTAAGTCACCCAGTCCCACTCGGGAGGTTCCAAGCACAACGTTTGTCGAAACACCACCAACTAGTCAGCAGCAGCAGCCAAAGGCGCAGGTGCAGCAAGAGCCAACAGCAACGGTCCAGTCCCCCGAGGATAACAGAGTGTCTTCTATGTCAGATGAAACTAACCTGGCGGAACAGGAGCAGCCTGCTCTTCAAGATTTCGTTAGCATGTTTAGACGCTGTCTTTGCTACTTCGCTCCTCCGTCATTCCGAGTCAAAAAGGACGACATCAAGGAGATGGGCACTGACGAACTGAGGGAATTTCCTCTGGAAAGCTTCTTTGATCACTATGAACGAGGACTCACGGAGTTGGTGGATGGTTTCCGGAAGGACAAGGACGAAGCCCTCAAAAAAGTCGCGGAAGCTGAGGAGCGTGTGAAGGAAGCAGACAACGAAAAAGAAAGATCAACAACTAAATTGTTAAATCTGAGGAAGAATGCAGCAAAACTGCTTCGTTTTATTCAAGAGGATCCAAACGAGTGTACAATAAGCGCAGATGATGTTTCGGATAGAGTGGATGAAATGATGGAAACCATAGCGCAACAGGCCGAGGAGCGATTATAG

Transcript

OS493_004402-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q69ZX6	ATPase MORC2A OS=Mus musculus OX=10090 GN=Morc2a PE=1 SV=2
Q9Y6X9	ATPase MORC2 OS=Homo sapiens OX=9606 GN=MORC2 PE=1 SV=2
Q8C5W4	ATPase MORC2B OS=Mus musculus OX=10090 GN=Morc2b PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004737 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07496 all species →	zf-CW	CW-type Zinc Finger	Domain	Interproscan
PF13589 all species →	HATPase_c_3	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	Domain	Interproscan
PF17942 all species →	Morc6_S5	Morc6 ribosomal protein S5 domain 2-like	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011124 all species →	Domain	Zinc finger, CW-type	Interproscan
IPR041006 all species →	Domain	Morc, S5 domain 2-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23337 all species →	ZINC FINGER CW-TYPE COILED-COIL DOMAIN PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004402-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004402-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

147.0Max TPM

55.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	41.08	72.80
polyp at pH7 6	18	18	39.44	59.05
coral polyp · control treatment	16	16	58.77	95.43
coral polyp · oil and dispersant treatment	16	16	78.04	101.13
coral polyp · oil treatment	16	16	45.76	68.98
coral polyp · dispersant treatment	16	16	95.21	146.97
Polyp	10	10	25.68	38.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	72.80
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	71.27
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.07
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	61.99
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.96
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.20
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.99
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.31
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.42
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.26
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.46
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.90
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.88
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.13
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.30
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.79
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.29
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.05
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.28
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.20
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.28
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.30
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.42
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.79
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.79
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.23
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.41
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.78
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.47
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.46
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.69
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.43
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.59
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.91
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.35
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.45
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.90
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.46
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.09
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.00
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.41
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.96
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.33
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.95
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.80
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.98
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	101.13
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	99.77
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.59
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.47
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.93
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.66
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.94
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.43
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.22
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.29
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.17
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.81
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.32
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.02
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.35
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.56
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	68.98
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.50
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.52
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.08
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.19
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.55
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.98
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.90
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.07
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.16
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.12
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.23
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.00
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.31
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.87
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	146.97
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	138.41
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	134.50
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	129.03
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	127.72
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	114.11
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	112.29
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	101.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	94.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	93.26
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	89.83
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.65
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.55
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.50
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	38.52
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	35.44
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	35.44
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	32.72
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	31.86
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	20.38
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.82
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	19.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	13.73
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.62

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.