Gene detail

Detailed information of OS493_004430-T1 in Lophelia pertusa

Genomic Location: scaffold_8:6432493...6443928
NR annotation: KAJ7387433.1, cytoskeletal adaptor [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004430-T1

ATGGCGGATCGTGGAAGGGATAAAACAGGAACGGTAGACAAGTGTATGGTGGCGATGAGGGAAGATTTAGCGCCGTGGTTGTCACATATCCTGAGTTTAGAGATAACGGTAGAGACGCTAATGGAAGATCTCGAAACAGGAGTGGTTTTGTGTAGACTTGCTAACGCGATCCAGAGAACAGGCGAACACTTTCTTCTCCATCACTGCGTTCAAGTTCCTCGAAATGCTTTTCCCCCTTGCGGAGTAACATACAAAGAGAGAACAGCCTTCCGCGGCTCTTTCATCGCTAGGGATAATGTTGCAAATTTTATTCGCTGGTCTCGGGAATTGGGAGTATCGGATATTATGATGTTTGAGACGGAAGACCTTGTTCTTCATAAGAACGAGAAGTCTGTTATTTTGACCCTTATGGAGGTAGCGCGGTTGAGCGTGAAATTCGGCGTCGAACCGCCGGATTTGGTCAGAATGGAGAACGAAATCGACCAAGAAATTGAACAGCAACCGGCGGAAATCTTGGAGGAGCCGATGATTCAGTTAAAAAAGAAACACAAATCGCACAGCCTGGATGATTTGGTTTATCAAGTATTGGAGCAATGCTCGTGCCCAGTGCGGTACCCAGTCCTCCGTGTCGGGGAAGGAAAATACCGAGTGGGCGAGGGCAAGTCGCTTATATTCGTCAGGGTCATGCGCAAACACGTGATGGTTAGAGTAGGAGGGGGCTGGGACACATTGGAGAGATATTTCGACAAACATGATCCTTGCAAGGTGACAGAGAGACACGAGAGAAGGAACTCAGTCAAATCTCCCAGAGCGCGGAGTGCAAGTGATGTGATTGGTAGATCGCCAAGCTCATTGAGTATCTCCAGTAGCGACAGTCATGATTCGTGTGGTCAACCAGCTTCTCACGGGCGCACTGCATCATGGACTTCTTCCCAGAATTCATCTTCACAGCTCAAGAGTCCACGAGAACCCGCGAGGCGAGTGACGAGTGTGTCTCCCTCAAGAAGTCCTTCGCCTTCCCAGTCTCCACGTCTACAACCGCGGCAAAGGCGTGGCACAATGTCACGTGACACGCCACCCAGGACCATGGACACGCAGTCAACTAAGCGGCTGTCAAGAAAGAGCCAAAGCATGCAGGAGCTAAGCAGCGTCCTTGTAGACGGTCGCAGCCCTTCCTATTCCAAACCGACTTCTTCATCGATTCGGAAACATAGCGTGACTGGTGACAGCGCTAGCCCCAGTGCCCCTGAGCAATCTCGCAGGAAAAGCTTAGCAACCAGCTCTCGGAGATCGTCCAACGTTGGGGCTCAAGGAGAATCTACAACTGCCAGGAGCCGTTTAAGTTCTAGCGGCCCTGTTGGCTCTCAAAGGCCTGGGCCTGCGGGGGTATCTAGAAGCGCCTCGTTTGGTTCCAGACCCCGCACCATGTTACCCGTGATGGAGCCTCGCTCTAAAACTATGGTCAACTCACGGCCAGCGAGAGAGACGCAGAGGAGAGCGTCCTCAGCCGTACCTGCGAAAGTTGACTGTCATAGGGACGAAACAAGGCGGAGGGAGCCTAGTGCCAAACGAAGGTCATCCTCAGCTGTGATCGACGGCAAGGCACGGTTACCTGGCTCACCGAAGCCCGCGCAGAGGTCAGCGGAAGATAAGCAAGATAAAAGTAGGAAGCCCAGTGTATCTAAGATACCCAGTCCTCGGCATAAACCGGATCAGCCTGTTACAAGGAAAATATCAACAGGAAGTACAGAACAGGCACGTGTTGTTCACAGATCCTTGCCATCTACCCCAAGAGAAAGAAAATCTTCCACGACTCAACAAAATGGCCCCCAAAATAACGCGGTGAAAGGTTCAAAAAGCAGCGCAGTTAAAGGCAAGACAAAAGAGCAACAAACGCCGCCCACTGCACGCCGCGAAAATAAATCGGTCATCCAAAGAAAGGAGCAGACAAGTAGAAAGGCGAATGAAAGTGTTGGTAAAGAAAGGACGGTGAAAAAAATCACGAAAAACGACCACAAGGACGAAAAGGAGATGAAAATGGGAGTGAACAAATTGAAGACAACGTGTTTGATATGTCCGTATGTGAGCATAGCCCCAGTATTGTCTCTAATGGACAACTGA

Transcript

OS493_004430-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0A1L8HFX9	GAS2-like protein 2A OS=Xenopus laevis OX=8355 GN=gas2l2.L PE=3 SV=1
Q5SSG4	GAS2-like protein 2 OS=Mus musculus OX=10090 GN=Gas2l2 PE=1 SV=1
A0A1L8H8C0	GAS2-like protein 2B OS=Xenopus laevis OX=8355 GN=gas2l2.S PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001140 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00307 all species →	CH	Calponin homology (CH) domain	Domain	Interproscan
PF02187 all species →	GAS2	Growth-Arrest-Specific Protein 2 Domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036872 all species →	Homologous_superfamily	CH domain superfamily	Interproscan
IPR001715 all species →	Domain	Calponin homology domain	Interproscan
IPR036534 all species →	Homologous_superfamily	GAR domain superfamily	Interproscan
IPR003108 all species →	Domain	GAR domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46756 all species →	TRANSGELIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0001578 all species →	Biological Process	microtubule bundle formation	Interproscan
GO:0001725 all species →	Cellular Component	stress fiber	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005884 all species →	Cellular Component	actin filament	Interproscan
GO:0008093 all species →	Molecular Function	cytoskeletal anchor activity	Interproscan
GO:0031110 all species →	Biological Process	regulation of microtubule polymerization or depolymerization	Interproscan
GO:0035371 all species →	Cellular Component	microtubule plus-end	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan
GO:0051764 all species →	Biological Process	actin crosslink formation	Interproscan
GO:1904825 all species →	Biological Process	protein localization to microtubule plus-end	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24627	GAS2, GAS2L; growth arrest-specific protein 2	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004430-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

39.5Max TPM

4.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.19	3.72
polyp at pH7 6	18	16	1.58	3.06
coral polyp · control treatment	16	16	7.95	39.53
coral polyp · oil and dispersant treatment	16	16	4.94	18.14
coral polyp · oil treatment	16	16	8.65	28.21
coral polyp · dispersant treatment	16	16	3.16	8.39
Polyp	10	9	1.21	2.12

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.72
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.38
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.26
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.22
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.18
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.09
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.54
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.52
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.87
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.47
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.45
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.41
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.13
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.09
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.74
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.06
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.84
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.61
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.09
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.08
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.05
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.03
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.99
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.58
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.51
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.70
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.56
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.53
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.69
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.91
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.71
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.69
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.54
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.08
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.73
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.48
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.43
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.39
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.30
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.75
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.61
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.14
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.54
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.58
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.01
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.79
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.30
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.27
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.19
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.53
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.41
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.34
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.93
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.68
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.04
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.92
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.21
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.95
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.57
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.09
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.19
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.54
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.56
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.46
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.40
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.68
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.77
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.50
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.39
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.71
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.40
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.06
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.29
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.15
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.61
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.29
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.85
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.34
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.28
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.90
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.81
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.12
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.09
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.99
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.89
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.34
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.46
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.43
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.38
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.