Gene detail

Detailed information of OS493_004616-T1 in Lophelia pertusa

Genomic Location: scaffold_9:2638588...2650342
NR annotation: KAJ7381021.1, hypothetical protein OS493_004616 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004616-T1

ATGTGCAAGCTGGAGGTAAATGCATGTATGTTGGAATCTGGAGGTATGCCTGCAGGAAAACTCACCTACCTTGGAAATGGAGAGTGCACAGTTGCACAAATCTGCAGTCTACCAGTAGAAAAAGGTCGCTGCCGTGCTTCCATGAAAAGATTCTTCTTTAACTCCACTTCTCGGCAGTGTGAAGAGTTCAGGTTTGGCGGATGTGAAGGAAATGCAAACAGATTTGACACGGAGAAGGATTGCCATGACTACTGTGGATCCCTGGATACCTGTCAGCTGAACCCTTGCGCAGATCCTTACGCCATCTGTAGTATTTCTGATGAAGGAGAGCGAGTGTGTACCTGCCCACAAGTTTGCACTGCTGACTATAGCCCTGTCTGTGGAACTGACGGACAAACGTATAGCAATGAGTGTATGATGAAGACTTCAGCTTGCCAACAAGGCATGATGATAAAGGTCAAATCACCTGGAAAATGTAACAACAATCCTGGTTTCTGCCCCACTGTGGACCCTATGATGTGCCCGGGTGATCAGGAAGATAGCTGCTTTGACGACGCAAGCTGTGAAGATAATGAGAAGTGTTGTCATGATGGCTGTAGAAAGATGTGTGTGAAGCCATTAGCAATACCCAATGCTGGTTTACCGCAGAAGATCGTGCCACAATTGGCCCCACTTCATTTTGATAAGAAGCCTTCTATCGAAGACCCATGTGAAAAATGCAAGTTTCCAAGGAGCGCTTGTACACTGAACGAGAACGGGGAAGCAGAATGCCAGTGTCCAGAGGTATGCACGGCAGACTTCGCTCCCGTCTGTGGCTCGGATGGTCGAAACTACACCAACAAATGCGAGTTAGAGGTGGAAGCTTGTAAACCAGAGAATCTACATACCTTGAAGCTTCTACATGAAGGACCCTGTGTGTGCAACCTTCCACCCGAAGGAGGACCATGCTTCGGCTATCTTCGACGTTACTTCTTCAATGCTACCACCAAACAATGTAAAGAGTTTGTTTATGGAGGCTGCCAGGGAAATGGCAATAATTTCCAAGACATTGAGAGCTGCGAGAATAAATGCATCAATCCATGCAAGAACTACAAGTGTCCGTTTCCTCATACGAGATGTGAAGTAGAAGGCGGAAAACCAGTTTGTAAATGTCCCATCGTCTGCACAGCAGATTACCGTCCAGTGTGTGGAACAGACGGCAAGACATACAGCAACATGTGTGGAATGGAGGCAGCTGCCTGCTTAACAAAGCATTTTAGACTGCAAGTCAAACACGTCGGAGAATGTTTAAGTCCAAACCCATGTAAAGAGGCTACCTGCAGCCACAAGCGTCATAGATGTATAGTGAAGGATAACGAGGCTGTGTGCGTATGCGATAAAGCATGCACGAGAGAGTATGAGCCACTGTGTGTCTCAGATGGTGCTACCTACCCTAACAAGTGTGTTCTGGAAGTTGAGGAGTGTGAAAGTGGAAACGCCTTGAAAATTGTACATTCAGGAGAATGCCAAGTCGATCAGCTGATCGGTTTTCTTACAACAAGATACTTTTCTCTAATTTACTTTTTTCTCTGTGCCACGCATAAAGGATCAAGACTCTCTTCTCGTGCAGCATGCCAGCTCCCTCCTGATGGTGGACCGTGTAAAGCTTATATCCCAAGTTACTTTTTCAACGCAACATCTAAAACTTGTGAAGAGTTTGTTTATGGAGGATGCCGAGGAAATGACAATCACTTCAGCACCATTGATGACTGCCAGGAAACCGAGACTCCAAGTTCAGACGATCCCTGCCAGTTAGTCAAGTGCGATTTCCATGGCGTTTGTCGAGTGGCTGATAATGGTTACGCTGTGTGTGAATGCAACACAGCATGTCCATTCATTTATGATCCAGTTTGTGGCTCAGATGGAAAGAACTACTCCAATGAATGTGTGTTGAAGTCACAAGCTTGCCTTACCAACACTGCCATAGAGGTTATTGGTGGCCCTGCTAAGTGTGCATCGAAAAGGCTGAAATGTCAGTCTTGTCCAGCTCGTTCAAACCTCTTCACTCACTTCTGTGAAAGCGGTTTTGTTTTCGAAGGCACGTTAGAGAAGATCGAAAGTAATGAAGATGCAGACTCCTCTAGCTTGATGGTGCTAGTGACGGGAGTGTTCAAGGGATCGGATTCAGTACAAAACAAAATCATCAAGATCAACTTTGCTGAGAACTTGAAGAGCTGTTTCTGCAAAGAGCTGGAGCTGAGAAAAGTAGTCATCATCGCTGGCTCCGTGACAGATGAAGGTGACTACCTTCTCGATGAATCCAGTTATGTGCGTCACGCAAGCCAACACCTGTTGAAGAAAGTTCAGGAGCGTACGAAACACAACAACTGCAAACAAGACTAA

Transcript

OS493_004616-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O00468	Agrin OS=Homo sapiens OX=9606 GN=AGRN PE=1 SV=6
P25304	Agrin OS=Rattus norvegicus OX=10116 GN=Agrn PE=1 SV=2
A2ASQ1	Agrin OS=Mus musculus OX=10090 GN=Agrn PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001990 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00095 all species →	WAP	WAP-type (Whey Acidic Protein) 'four-disulfide core'	Domain	Interproscan
PF07648 all species →	Kazal_2	Kazal-type serine protease inhibitor domain	Domain	Interproscan
PF00014 all species →	Kunitz_BPTI	Kunitz/Bovine pancreatic trypsin inhibitor domain	Domain	Interproscan
PF01759 all species →	NTR	UNC-6/NTR/C345C module	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002350 all species →	Domain	Kazal domain	Interproscan
IPR008993 all species →	Homologous_superfamily	Tissue inhibitor of metalloproteinases-like, OB-fold	Interproscan
IPR036058 all species →	Homologous_superfamily	Kazal domain superfamily	Interproscan
IPR020901 all species →	Conserved_site	Proteinase inhibitor I2, Kunitz, conserved site	Interproscan
IPR003645 all species →	Domain	Follistatin-like, N-terminal	Interproscan
IPR036880 all species →	Homologous_superfamily	Pancreatic trypsin inhibitor Kunitz domain superfamily	Interproscan
IPR008197 all species →	Domain	WAP-type 'four-disulfide core' domain	Interproscan
IPR002223 all species →	Domain	Pancreatic trypsin inhibitor Kunitz domain	Interproscan
IPR001134 all species →	Domain	Netrin domain	Interproscan
IPR036645 all species →	Homologous_superfamily	Elafin-like superfamily	Interproscan
IPR052132 all species →	Family	WAP, Kazal, immunoglobulin, Kunitz and NTR domain-containing	Interproscan
IPR018933 all species →	Domain	Netrin module, non-TIMP type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45938 all species →	ACP24A4-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004867 all species →	Molecular Function	serine-type endopeptidase inhibitor activity	Interproscan
GO:0005576 all species →	Cellular Component	extracellular region	Interproscan
GO:0030414 all species →	Molecular Function	peptidase inhibitor activity	Interproscan
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan
GO:0007179 all species →	Biological Process	transforming growth factor beta receptor signaling pathway	Interproscan
GO:0048019 all species →	Molecular Function	receptor antagonist activity	Interproscan
GO:0050431 all species →	Molecular Function	transforming growth factor beta binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004616-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004616-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

770.0Max TPM

236.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	241.03	402.77
polyp at pH7 6	18	18	258.24	393.96
coral polyp · control treatment	16	16	235.03	428.01
coral polyp · oil and dispersant treatment	16	16	264.03	770.01
coral polyp · oil treatment	16	16	284.47	562.72
coral polyp · dispersant treatment	16	16	227.83	550.29
Polyp	10	10	85.79	140.45

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	402.77
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	388.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	379.71
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	374.58
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	284.89
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	279.77
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	256.15
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	253.07
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	252.20
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	244.87
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	191.94
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	190.34
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	154.48
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	152.78
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	137.65
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	134.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	130.41
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	129.67
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	393.96
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	391.28
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	307.44
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	304.32
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	299.45
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	298.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	256.14
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	252.38
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	250.93
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	250.32
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	250.08
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	244.20
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	208.26
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	200.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	198.04
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	188.93
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	177.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	176.43
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	428.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	323.21
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	299.81
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	289.91
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	277.89
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	271.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	259.60
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	223.85
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	223.64
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	211.98
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	197.89
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	187.19
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	167.21
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	149.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	127.83
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	121.57
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	770.01
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	466.63
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	409.83
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	360.91
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	326.41
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	239.51
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	234.93
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	223.91
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	204.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	197.62
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	189.45
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	158.04
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	142.48
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	140.24
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	95.28
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.36
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	562.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	495.89
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	480.91
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	375.77
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	348.67
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	308.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	291.71
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	284.25
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	250.38
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	248.67
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	239.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	190.12
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	186.48
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	149.91
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	83.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.89
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	550.29
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	389.58
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	357.32
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	348.49
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	336.15
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	310.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	187.46
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	173.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	170.07
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	164.54
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	157.60
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	151.01
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	124.33
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	99.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	89.80
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.88
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	140.45
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	121.20
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	119.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	96.89
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	84.12
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	76.24
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	63.93
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	63.79
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	61.92
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	29.97

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.