Gene detail

Detailed information of OS493_004634-T1 in Lophelia pertusa

Genomic Location: scaffold_9:2827906...2855578
NR annotation: KAJ7381038.1, hypothetical protein OS493_004634 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004634-T1

ATGCCATCAAAACGGAAACATTCTTATACTGGTAAAAAGCTGACTGATCAAAACACTCTGAAAGGTGCCCTGTCTGCTCTTGACCAAGAAATTGCGCCTGATTCTCCACCTGCAAGTTCAAGCAAAGGATACCGCAAGTCTCTGGCTCTTGGCCTGTTTTACAAGACATCTGGTGAGGCTCAGTACGTATCTGACATTCCCATTCAAGGTGGTGAACTCTATGCCGCCTTCGTTGTCAGCACAAAGGCAAACTGTAAGATTGATTCCCTTGATGCGTCAGAAGCCCTAAAATTGCCTGGAGTTGTCAAATGTATCACAATATTAGACATTCCCAAAGGAGGTATCAACAATTTCATGCCAACGTCTTTTGGTTTTGCATCTGAGGAGATATTTTGCAGTGGAGATGTTTGCATATGCTGGTCAAGCTTTGGGTCTCATTATTGCTGCCAAGTCATTCTTGATCCCCAGGCTAAACCATTGAAAAAAGGCGATCCAGATACTGCAATTAAAAATTCGCCACATATTGTGCAGGGTGCTGTATCTACTGGACCACAGTACCACTTCCACATGGAAACTCAGGTGGCACTGTGTGTCCCAGAAGACGATGGCATAACTGTTCACTGCCCAACCCAGTGGGTTGATCTCACTCAAGCAGCTGTAGCTCAAACTCTGAATTTTCCTGTTCAAAGTGTTAATATGAGTGTGAAGAGGTGCGGCGGTGCATATGGAGCCAGGATCACCAGAGCCAATCACATTGCTACAGCTTGTGCATTAGCTGCCTATGTCACAAAGAGACCCGTTCGACTGAGGTTGGATTTGAACACTAATATGGAGATGGTTGGATTGAGAGAACCATACAAAGCAACTTACAAGGTGGGTGTGGCAAAGGATGGCAAGTTAAATGGCATTGATATGAACTTGTACTGTGATTGTGGTTCTTCTGTAAATGACGTTGATGTGTTGTATGCTCAAGCATGGTCTGACAATGCATACTTTTGTGACAACTGGAACATTGTCCCTTATGCTACTCATACCCACACAGCAGGAAACACTTGGTGTCGTGCACCAGCATCCACTCAAGCAGTGTTTATAATAGAGACAATCATGGAACATGTTGCAAAAGAAATGAAAATGACACCAGAAGATATTAGAAAAGCAAATTTCTATAAAAATGGACAGGAAACTCAGATGAATCAGACGCTGAAATATTGTAGCATATCCACTCTGTGGAATGATATCCTTGTGTCAAGTGACTTCCGGAATAGAAAGATTGCAATTGACACTTTCAACAAGCGTTGTCCCTCTCAAATATGGAGTAGGCTGGGAGGGTGCCCAGTTCACTGCAATGGTGTCGATATACCACGCGGATGGCACAATAGCCATTGTCATGGAGGAATTGAAGTTGGACAAGGAATAAACACAAAGGTAGCTCAAGTTGCGGCATACCAGCTGAAGTGTCCTCTGGAAAAGATTGCCATCAAACCCACTACAGCATTCAGCAATCCAAACAGTGCTGGTACTGGTGGAAGCATTACAAGTGAATTATGTTGTAAGGTGGGTAGAGTGGGAACTGAGATCCACTTTTATCCCATTGAGACTGTTATGGGTTGTTGTGACATCTTAAACAAAGTGATTGATCCAGTCAGACAAACCATGCCTTCTGCCTCCTGGGCTGACTTAATTACCAAATGCTACAGCAGTGGCGTGGATTTATCAGCTAAATATAGGTTCATAGATACGAGTCAACCGCCTTATGCCTACAACACATATGGAGTGACATGCACTGAGGTGGAGCTGGATGTGCTGACAGGAGAAAGAGAGATTTTACGCACAGACATACTTAATGACTGTGGACAAAGCATGAACCCTGAACTGGATGTAGGCCAAGTGGAGGGAGCGTTTGTGATGGGGCTTGGTTTTTGGCTGACAGAGAAAATTATCTATGATCCTGACACAGGAAGAAATCTGACCGCTGGAACATGGGAATACAAGCCTCCTTGTTCAAAGGACATACCAATTGACTTCAGGGTGTCATTGTTGAAGAATGCACCCAATCCACTCGGCATTCTCAGGTCCAAAGCTGTGGGTGAGCCCCCTTTGTGCATGTCCTGCGCGTGTTTGTTTGCCGTGAAGCATGCGGTGGAAGAGGCACGTACTGAGATTGGCAAAGGAGATGGTTATTTTGTCATGAATGCCCCCTCCACGGTTGAGGACACACAGTTAGCGTGTCTTGTGGACCCCAGTCAGTTCACCTTGTGA

Transcript

OS493_004634-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P47990	Xanthine dehydrogenase/oxidase OS=Gallus gallus OX=9031 GN=XDH PE=1 SV=1
Q00519	Xanthine dehydrogenase/oxidase OS=Mus musculus OX=10090 GN=Xdh PE=1 SV=5
P47989	Xanthine dehydrogenase/oxidase OS=Homo sapiens OX=9606 GN=XDH PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001251 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20256 all species →	MoCoBD_2	Molybdopterin cofactor-binding domain	Domain	Interproscan
PF02738 all species →	MoCoBD_1	Molybdopterin cofactor-binding domain	Domain	Interproscan
PF01315 all species →	Ald_Xan_dh_C	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046867 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, second molybdopterin binding domain	Interproscan
IPR000674 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead	Interproscan
IPR008274 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, first molybdopterin binding domain	Interproscan
IPR037165 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding domain superfamily	Interproscan
IPR016208 all species →	Family	Aldehyde oxidase/xanthine dehydrogenase-like	Interproscan
IPR036856 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11908 all species →	XANTHINE DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00106	XDH; xanthine dehydrogenase/oxidase	EC:1.17.1.4 EC:1.17.3.2	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004634-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

73.4Max TPM

25.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	38.48	52.46
polyp at pH7 6	18	18	37.63	73.45
coral polyp · control treatment	16	16	21.46	44.69
coral polyp · oil and dispersant treatment	16	16	16.95	50.12
coral polyp · oil treatment	16	16	25.47	58.44
coral polyp · dispersant treatment	16	16	16.66	34.59
Polyp	10	10	17.03	30.96

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.87
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.80
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.03
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.10
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.08
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.16
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.43
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.41
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.62
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.00
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.88
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.57
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.31
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.37
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.45
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	71.59
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.57
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.58
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.74
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.88
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.26
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.09
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.50
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.44
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.22
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.85
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.17
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.32
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.68
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.69
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.41
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.73
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.78
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.30
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.57
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.09
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.02
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.17
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.09
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.83
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.20
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.15
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.12
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.38
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.38
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.80
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.04
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.09
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.63
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.73
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.46
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.12
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.02
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.92
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.58
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.45
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.77
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.75
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.44
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.90
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.15
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.77
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.16
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.71
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.09
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.21
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.29
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.54
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.05
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.88
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.45
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.73
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.10
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.69
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.71
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.12
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.42
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.06
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.04
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.89
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.57
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.90
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.87
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	30.96
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	27.81
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	23.66
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	23.01
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	22.87
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.83
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.39
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.90
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.05

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.