Gene detail

Detailed information of OS493_004636-T1 in Lophelia pertusa

Genomic Location: scaffold_9:2873208...2897598
NR annotation: KAJ7381040.1, hypothetical protein OS493_004636 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004636-T1

ATGCATGCCATCAAAACGGAAACATTCTTATCTGGTAAAAAGCTGACTGATCAAAACACTCTGAAAGGTGCCCTGTCTGCTCTTGAACAGGAAATTGTTCCCGATTCTCCGCCTGCAAGTTCAAGCAAAGGATACCGCAAGTCTCTGGCTCTTAGCCTGTTTTACAAGTTCTATTTGACTGTTCTTGGAGACAAGGCATCAGCAAGGGTTAAATCAGCGGCGGAGCCCTTCATTCGCGCTGTGTCCACCGGCTCGCAGAGTTATGACTCGCAATCTAAGGAATATCCATTAACTCAACCTATGACTAAACTGGCTGCCAAACTACAGACATCTGGTGAGGCTCAGTACGTATCTGACATTCCCATTCAAAGTGGTGAACTCTATGCCGCCTTCGTTGTCAGCACAAAGGGAAACTGTAAGATTGATTCCCTTGATGCGTCAGAAGCCCTGAAATTGCCTGGAGTTGTCAAATATATCACAGTGTCAGACATTCCCAAAGGAGGTATCAACAATTTCATGCCAACGTCTTTTGGTTTGCATCTGAGGAGTGGAGCCGTTGCATATGCTGGTCAAGCTTTGGGTCTTATTATTGCTGATACTCAGCGGCATGCAGATGAAGCAGTGAAATCAGTGACAGTCACATACAAAGAACAGAAGCCTCCTCTGCTAACTATCGATGAAGCTGTAGCAGCCAAGTCATTCTTTGATCCCCAGGCTAAACCATTGAAAAAAGGCGATCCAGATACTGCAATTAAAAATTCTCCACATATTGTGCAGGGTGCAGTATCTACTGGACCACAGTACCACTTCCACATGGAAACTCAGATGGCACTGTGTGTACCAGAAGACGATGGCATAACTGTTCACTGCCCAACCCAGGGGGTTGATCTCACTCAAGCAGCTGTAGCACAAACTCTGAATTTTCCTGTTCAAAGTGTTAATATGAGTGTGAAGAGGTGCGGCGGTGCATATGGAGCCAGGATCACCAGAGCCAATCAAATTGCTACAGCGTGTGCATTAGCTACTTATGTCACAAAGAGACCCGTTCGACTGAGGATGGATTTGAACACTAATATGGAGATGGTTGGGTTGAGAGAACCATACAAAGCAACTTACAAGGTGGGTGTGGCAAATGATGGCAAGTTAAATGGCATTGATATGAACTTGTACTGTGATTGTGGTTCTTCTGTAAATGACATTGATGTGTCATTAGCTCAAGGATGGGCTGACAATGTATACTTTTGTGACAACTGGAACATTGTCCCTTATGCTACTCATACTAACACAGCTGGAAACACTTGGTGTCGGGCACCAGGATCTGTTCAAGCAGTGTTTATAATTGAGACAATCATGGAACATGTTGCAAAAGAACTGAAAATGACACCAGAAGATATTAGAAAAGCAAATTTCTATAAAAATGGACAGGAAACTCAGATGAATCAGACGCTGAAATATTGTAGCATATCCACTCTGTGGAATGATCTCCTTGTCTCAAGTGACTTCCAGAATAGAAAGATTGCAATTGACACTTTCAACAAGAATAATCGCTGGCGGAAGCGTGGAATCAGTGTTGTCCCTCTCAAATATGGAATAAGCTGGTTAGGTGAACAGTTCACTGCAATGGTGTCGATATACCACGCGGATGGCACAATAGCCATTGCTCATGGAGGAATTGAAATTGGGCAAGGAATAAACACAAAGGTAGCTCAAGTTGCGGCATACCAGCTGAAGTGTCCTCTGGAAAAGATTGCCATCAAACCCACTACAGCATTCAGTAATCCAAACAGTGGTAGTACTGGTGCAAGCATTACAAGTGAATTGTGTTGTAAGACTGTTATGGGTTGTTGTGACATCTTAAACAAAGTGATTGATCCAGTCAGACAAACGATGCCTTCTGCCTCCTGGGCTGACATAATTACCAAATGCTACAACAAGGGCTTGGATTTATCAGCTAAATATATGTTCATAGACACGAGCCCACCGCCTTATGCCTACAACACATATGGAGTGACATGCACTGAGGTGGAGCTGGATGTGCTGACAGGAGAAAGAGAGATCTTACGCACAGACATACTTAATGACTGTGGACAAAGCATGAACCCAGAACTGGATGTAGGCCAAGTAGAGGGAGCATTTGTGATGGGGCTTGGTTTTTGGCTGACAGAGAAAATTATCTATGATCCTGACACAGGAAGAAATCTGACCGTGGAACTTGGGGTGTCATTGTTGAAGAATGCACCCAATCCACTCGGCATTCTCAGGGCCAAAGCTGTGAGTGAGCCCCCTTTGTGCATGTCCTGCGCATGTTTGTTTGCCGTGAAGCATGCGGTGGAAGAGGCACGTACTGAGATTGGCAAAGGAGATGGTTATTTTGTCATGAATGGTCCCTCCACGGTTGAGGACACACAGTTAGCGTGTCTTGTGGACCCCAGTCAGTTCACTTTGTGA

Transcript

OS493_004636-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q12553	Xanthine dehydrogenase OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) OX=227321 GN=hxA PE=2 SV=2
P47990	Xanthine dehydrogenase/oxidase OS=Gallus gallus OX=9031 GN=XDH PE=1 SV=1
P80457	Xanthine dehydrogenase/oxidase OS=Bos taurus OX=9913 GN=XDH PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001251 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02738 all species →	MoCoBD_1	Molybdopterin cofactor-binding domain	Domain	Interproscan
PF20256 all species →	MoCoBD_2	Molybdopterin cofactor-binding domain	Domain	Interproscan
PF01315 all species →	Ald_Xan_dh_C	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain	Domain	Interproscan
PF03450 all species →	CO_deh_flav_C	CO dehydrogenase flavoprotein C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008274 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, first molybdopterin binding domain	Interproscan
IPR016208 all species →	Family	Aldehyde oxidase/xanthine dehydrogenase-like	Interproscan
IPR000674 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead	Interproscan
IPR046867 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, second molybdopterin binding domain	Interproscan
IPR037165 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding domain superfamily	Interproscan
IPR036683 all species →	Homologous_superfamily	CO dehydrogenase flavoprotein, C-terminal domain superfamily	Interproscan
IPR036856 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead superfamily	Interproscan
IPR005107 all species →	Domain	CO dehydrogenase flavoprotein, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11908 all species →	XANTHINE DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00106	XDH; xanthine dehydrogenase/oxidase	EC:1.17.1.4 EC:1.17.3.2	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004636-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

54.8Max TPM

25.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	33.81	54.80
polyp at pH7 6	18	18	31.17	44.74
coral polyp · control treatment	16	16	24.40	50.95
coral polyp · oil and dispersant treatment	16	16	16.10	27.55
coral polyp · oil treatment	16	16	27.26	40.18
coral polyp · dispersant treatment	16	16	18.51	28.52
Polyp	10	10	25.81	39.53

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.80
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.61
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.93
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.82
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.39
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.33
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.84
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.12
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.45
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.04
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.64
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.87
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.83
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.89
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.28
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.74
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.79
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.71
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.66
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.64
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.38
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.61
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.16
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.76
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.46
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.33
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.95
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.45
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.58
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.75
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.74
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.45
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.81
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.37
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.08
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.90
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.39
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.83
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.55
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.59
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.19
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.72
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.16
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.91
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.85
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.33
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.93
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.08
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.89
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.44
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.84
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.18
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.75
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.55
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.39
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.49
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.88
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.29
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.83
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.22
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.14
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.74
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.31
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.77
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.98
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.52
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.32
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.34
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.09
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.72
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.41
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.95
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.70
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.94
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.06
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.58
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.35
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	39.53
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	34.91
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	34.07
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	33.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	32.48
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	22.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	21.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.80
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	10.63
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.27

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.