Gene detail

Detailed information of OS493_004712-T1 in Lophelia pertusa

Genomic Location: scaffold_9:3799446...3820424
NR annotation: KAJ7381114.1, hypothetical protein OS493_004712 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004712-T1

ATGGCCTTCTTTACAAAGGGAGACCATGTGTGGCTTTCTATAAAAGATGTGAAGAACTTTGATGTTCCTATTGGTGCTGTGGTAAAATCAGTGGATGGACTGGGTATGCTGCTCACAGACGATCATGGAGAGGAACGCTTTTTAACTGGATCTTCTCTCGGTGACGTTCAATCGATGCCATCCCAGCTATACTATAGCCACAAAATCTACACGCATATAGGCATGGTGCTGGTAGCAGTAAATCCGTACCAGCTGTATCCAATCTATGGTACACATCACATAGACAAGTACAGTCAACAAACAGATGTGACACTGCTGCCGCCTCATATATTCTCTACAGCACAACATGCATTCACTTCCATGAAAAGACGACTCCAGAACCAAAGTATTATAATCAGTGGTGAAAGTGGAGCGGGAAAAACAGAATCGACCAAGCTGATTCTGCGCTACTTGACAGCTGTGGGCGGTCAGCATACCACACTGGATCAACAAATTCTGGACGCAAATCCAATATTAGAAGCGTTTGGCAATGCAAAGACCGTGAGAAACGACAACTCAAGTCGGTTTGGAAAGTACATCAATATATACTTCAACAGGAATGCGATTATCGAAGGAGCGAGAATTGAGCAGTACCTCCTAGAAAAGTCAAGAATTGTGTATCAGATGCCTGAAGAACGAAACTATCATATTTTTTATCGTCTGCTCGCCGGACTGACTGTGAACGAGAAGAAAAGCCTCCATCTCACGGTAGCAAAAGATTATCACTACCTCTCCCAAGGGAACTGTTTTGTCTGCGAGGGAATGGACGATAAGCAGGAGTTCGCTAACATTCGGAGAGCAATGAAGGTATTGATGTTTTCTGAAGAAGACAGTTGTATAATCTTCACTCTCTTGGCCGCCATTCTACACCTTGGGAATCTTCGCTTTCAAGCCTTGATTCAAGACAACATGGAGGCCTGTGCGATTTCAAATAATGACACAGTTGACTCAATAGCACATTTACTGCAGATTCCTTCAGAAAATATTCACGAGGCGTTCACAAGCAAATCAACGTACGCCTCTGGCGAGCTGATCTACTCTCCTATCGCAGAAGAGAGTGCAAGGCACATCAGGGATGCTTTTGTGAAAGGAATTTATGGAAGACTCTTCATTTGGATTGTCAGTAAAATTAACTCGTCCATTAGTAAACCAGCGGCTGATTCAGAGGGCTGTGTTTCCCTTGGTGTTCTAGATATTTTCGGTTTTGAAAACTTTGAAGTTAATAGTTTTGAACAGTTATGCATCAATTACGCAAACGAGAAACTACACAGCTTTTTCGTGGATCACGTGTTTAAGATGGAGCAGGCTGAGTACAGTCGCGAGGGTCTGGAATGGAGTCCTGTGGATTTTGTCGATAATCAAGAAGTTGTAGATACTTTGGCACAGAAGCCAATGAACTGTTTCGCTCTAATGGACGAGGAGAGCAGATTTCCTCAGGAAGCGACGAATCCTTTTTACAGAAAATCAATTCCCAACACGTCGCTCTCGAGGGCATCTTTTGGTGTGGTACACTTCGCGGGAACAATTCACTATGACGTCAGAGGAATTCTCGACAAGAATAAAGACACATTCAGCGCTGATCTCGTGGGACTTGTTTGCGAGAGTAACATGGAGTTTCTCTTTAACTTGTTTGCCAAAGAGATGTCGATGGGTGAAGAAACAAGGAAAAGATCGCCAACACTCAGCGCGCAGTTCAGAAGATCTTTAGATGTGCTAATGAAGATATTACTGAGCTGTGAGCCGTCATTTGTTCGTTGCATTAAGCCTAATGATCTAAAAACACCCATGGTATTTGACCGTTACATCTGCTGGCAACAGCTCAAATACTCGGGAATGTTGGAGACAGTCAAGATTCGTAAAGCTGGATTTGCTATTCGTTACACGTTTGAGGAATTCTACAACAGATATCATGTCGTTATGAAGGACTTGAAGCTTCCCCGCGATGAACCACGAGAAATGTCAGAGGCCTTAGCAAAAAGACTCCTTGGCGATTTAGAATGGACTATTGGTCATCGAATGATATTCTTAAAGGATCACCACGGAGACATTCTTGAACAAGCCCGCGATGGTTTACTCACCAATGCAGTGGTTATTCTTCAAAGGACGATAAAGAAGTTCTTACGTCATAGGAAACGTCATAATCAGACATGCGCAGCTGTCTTAATTCAAAAGACTTGGAAAGGATACTACGACAAGAGAGCATACCACAAGGTTCTAAAAGGAATAACTAGACTCCAGGCTGTTATTAAGGCTCGTCTTTTATCCGCCAAGTTCAAACGCATGCGCGAAGAGAAGCAGAGAGATGAACAAGACAGGCTGCGAAGACTGGAGCGAGAGAAACAACAGAAAGAGAATGAAGCCAGAATAAAGAAGGATCAGGAAGAAGCAGCTACCCAAATTCAGCAGATGTTCAGCTTTATTTCCAAAGAAGAAGAAACGTGTACTGAGACAGCATCCGATCAGCAGAGATCGTCACTGGGTCGCACGCCATTACGAGAACCAAACAAGGATTCGACGCCTTCGTCGTCTTTGGGAGCAAGCCTAGTAGATGGTATCAGAAGAATAGAGCAATCTAACAGACCAGCTCATTTGAGTTACAGCCCCAGGCCCAGCGTGTTGAATGGGTTAGGCCAGGTTACCCAGTCCCATTCGTCCGAACTTGCCTTGACTTTGACAGCGCTTGTACTCGGATTAGCCTTCCAGCAGGGATCCACCAATGAGAGCCAAGCAACTTCATCACGTGACGAGCCTGATACCGCGACAACATCGAGGGAGTCTGAATTTGTGTCCCCTCTGCGCTCAAAGCCTAAGGGCCCTCGTGGATCTGCTCGGTGGCGCACGGACCAATCATGA

Transcript

OS493_004712-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q29P71	Myosin-VIIa OS=Drosophila pseudoobscura pseudoobscura OX=46245 GN=ck PE=3 SV=1
Q17LW0	Myosin-VIIa OS=Aedes aegypti OX=7159 GN=ck PE=3 SV=1
Q9V3Z6	Myosin-VIIa OS=Drosophila melanogaster OX=7227 GN=ck PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000878 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00063 all species →	Myosin_head	Myosin head (motor domain)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036106 all species →	Domain	Class VII myosin, motor domain	Interproscan
IPR001609 all species →	Domain	Myosin head, motor domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR051724 all species →	Family	Actin-based Motor Myosin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46049 all species →	AGAP003327-PA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003774 all species →	Molecular Function	cytoskeletal motor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016459 all species →	Cellular Component	myosin complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004712-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004712-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

13.3Max TPM

3.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	16	1.78	4.10
polyp at pH7 6	18	16	1.18	2.06
coral polyp · control treatment	16	16	3.58	7.55
coral polyp · oil and dispersant treatment	16	16	3.14	7.91
coral polyp · oil treatment	16	16	3.34	8.30
coral polyp · dispersant treatment	16	16	3.11	8.34
Polyp	10	10	6.20	13.34

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.10
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.96
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.24
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.13
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.75
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.93
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.79
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.73
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.65
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.62
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.31
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.83
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.69
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.63
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.51
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.82
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.74
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.48
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.47
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.44
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.25
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.60
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.55
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.50
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.26
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.55
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.08
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.60
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.59
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.53
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.49
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.59
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.59
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.99
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.25
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.51
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.04
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.98
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.98
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.72
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.91
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.80
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.84
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.41
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.75
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.17
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.00
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.83
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.47
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.13
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.07
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.63
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.87
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.84
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.52
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.30
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.42
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.49
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.11
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.79
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.25
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.35
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.18
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.92
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.91
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.24
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.10
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.09
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.68
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.34
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.78
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.92
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.39
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.82
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.52
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.49
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.90
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.65
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.16
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.95
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.34
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.56
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.22
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.62
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.01
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.52
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.49
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.50
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.47

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.