Gene detail

Detailed information of OS493_004932-T1 in Lophelia pertusa

Genomic Location: scaffold_10:1210094...1215997
NR annotation: KAJ7374594.1, Ankyrin repeat domain-containing protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_004932-T1

ATGGCCGCTGCAAGGAGTCTGATGGCTAAAACCCTGTCTGGTACAAACGCTGCGTCTCCAAAGACGCCCAGCAACGCAGTTGTGACAGAAGCAGTGCCTTTACATATCACTCCCTTGGACTCTATCGACTCGGAGCGAGATCCCGATACGCCGCACAAAGAACCCACAAGTACTTATAAAAAGAAATCAGGAAAACTTGTATCCAAACGAAAGCTTTTTCTGCAAAGTGGACAAAATCTTCACATAAATAAAGCTAAGAGACATGCTAGTCCAAAGACGCCAAATGCTGCCACTCCAGCCCCAAGGCCAGCAGATTGTTCCAGGCCTCATTTTCCGCTAACAGAACGTCAGCAGCTGCAATACCTCTTGGAAGTAACAGCTAAGGAGGCAAAAGATTCCGGGTCCGCCAGCAGCAGCAATGATGATTTACCATGCACCAACAAAGCAGCTAAGAAAGACGCAAGCAAGGACTTGAATCACTTTGAGGCTCGTATACGGAAGAGGAATGAACGGGGAGAAACTGCACTGCATGTTGCGGCCATAAGAGGCGATGTGGAGGACCTTGTTGCCTTGATAAAAGCTGGAGCTTTGGTAAACGCCAAGGATAATGCTGATTGGACACCCCTTCATGAAGCCTGTAACTATGGCAACCTCAGCATTGTCCAGGAATTAGTGTGGTCTGGTGCAGATGTCAATAGTCCAGGTTATGAAGCTATCACTCCGTTGCATGATGCTGTTATCAATGATCACGTCAAGGTTGTAAAGTTTCTGTTAGAGAACGGAGCAGATTTAAAGCTGCAAACATCTCAAAACTACAGTGCATCAGACTTAGCACGGTCTGAAGCGGTTTTAAGCCTGGTGAGTCCAGAAGAACGAACAACAAGAGACTGCCACCCTATCAACTCTCAAGAGTTCCTTGCTCATGCTCAATACAGCGACGCCAACTTCAACATACCAGGAATCAAAATCAATGGTTTAAATAGTTATTTCCTTCAAAGAAGCTCATATGGTGATAGACTTGATCAAGCAGAGGGCGGCACAAAGACCTCTCTGCCTCATGGTTTTTCATTTCAAGGTGCTCGAGATGTGGAAATGCATATAAATCCACAGGAAAATTTTGTAGTCGGAGTGTATGGATTTCCTGGAAATTCTTACCATTTTACTAATGAAGCAGATGTTAGCAAAGAAAAGGAAGCTATCAATGCAAAATTTTCATCTAAGGGAGCTGCAGAAAATAACGACAATGAAACGCATGATAATACAGCCTGGCATTTTCAGAAGTCACCGTGTTACAGTGTTGGTTCTGTAGAATTGCAACTCAATGGACATGCTGAAGTTGTAAAGAAAATAAACAGATCTGCAGCTGCTAAGGAGCTTGATCAAAATGTTATCAATGACTCTTCTTCATTGATGACTTGTCCAAACAACTTAAAGGGGCCTGTTGCTGAAGATCTTGGCGCCCAAATAAATATGATAAACATTCCTGCCAAGAAACCTGGTCTGACTGTGACATCAGAGAGCGAGGAAGACACAGTTGTACCAGAGAAATTGAATGCATGTCTTGATAAGGCAATGATTGAAATTTCTTCATACTTAAACACCAGCCAAAAGGTAAACATGGAAGTGCCGTGCATTGAAAGGGACCTGAACAAATGCAATGTAGATCTATTGAAAAATGACGCAACCCTGATTGGTAAAAGTTCATCAAGTGAATCTGTCAATGCGAACTCGCCTCAAAGACCTGAACCAATAGAGAATTCTTTAAATCTTGTCAATCACCATGATGAGCAACAGCCATCTGTTACTTGTAGCTCTACTCTACCCAATAGATTGGAGTGTAAAGAAGACGCGACCAAAGTTTTTGCTGAAGAAGTAAATACCGATACAACTAACTGCATTGAACAACAGCCACTTATGAATTTCACAAAAATCAAGCCAAGAAATGACAAGAAAAAAGACAGTGGTATGTCGGAGAGAAGTGGTAAATCTTCCAGAAGAAAACGGTCATCAACAAGATCTTCTGACATTAGCAAAAGTGAGAGCAGTCAGAGCTTGATAAAAGAAGAATGTACAAGTCACATTGCGAACAGGTCATGGAGGTCGGATCTGCCCAAATACAGGTACAGCTTGTCGGCCACACCACTTTGTGTCCCTGGCTATGAAGATTTCCTAATAAACAGCAAGAGCGGATCAAAATCTTTATCAAAATGA

Transcript

OS493_004932-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6UB98	Ankyrin repeat domain-containing protein 12 OS=Homo sapiens OX=9606 GN=ANKRD12 PE=1 SV=3
E9Q4F7	Ankyrin repeat domain-containing protein 11 OS=Mus musculus OX=10090 GN=Ankrd11 PE=1 SV=1
Q6UB99	Ankyrin repeat domain-containing protein 11 OS=Homo sapiens OX=9606 GN=ANKRD11 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005938 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR053210 all species →	Family	Ankyrin repeat domain-containing protein 12	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24149 all species →	ANKYRIN REPEAT DOMAIN-CONTAINING PROTEIN 12	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005654 all species →	Cellular Component	nucleoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_004932-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_004932-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

37.4Max TPM

3.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.55	4.83
polyp at pH7 6	18	18	3.15	5.38
coral polyp · control treatment	16	16	4.79	37.43
coral polyp · oil and dispersant treatment	16	16	2.95	29.84
coral polyp · oil treatment	16	16	2.21	5.38
coral polyp · dispersant treatment	16	16	2.00	4.26
Polyp	10	8	1.80	3.71

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.83
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.55
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.52
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.50
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.24
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.95
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.79
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.71
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.64
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.55
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.98
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.91
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.80
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.77
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.73
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.14
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.38
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.30
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.20
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.16
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.70
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.57
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.24
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.09
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.80
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.71
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.60
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.29
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.12
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.94
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.98
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.43
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.36
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.01
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.51
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.15
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.98
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.52
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.97
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.77
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.74
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.37
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.32
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.14
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.38
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.84
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.08
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.86
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.46
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.27
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.04
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.86
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.80
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.77
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.62
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.45
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.36
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.38
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.57
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.20
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.63
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.40
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.10
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.40
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.10
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.81
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.65
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.26
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.23
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.01
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.51
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.15
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.95
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.80
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.70
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.64
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.15
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.72
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.69
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.32
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.71
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.07
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.83
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.64
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.22
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.85
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.88
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.81
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.