Gene detail

Detailed information of OS493_005138-T1 in Lophelia pertusa

Genomic Location: scaffold_10:3227075...3241726
NR annotation: KAJ7374788.1, hypothetical protein OS493_005138 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005138-T1

ATGGAAACTGAACTGAACTTCAGGACTAAACGCCCGAGGGAAGGTAACATTACGGAGAATGTACAGCTTAAATTCAAGCGTTTATTGGAAAGCACTCAAGCCACAGAACTTACAAGTGCTGTTGAAACCAAGGATGAACTAAAGAAGACAATTCTGCACCTGGTTGATGATAACCTAAGTTTTGAGGGCATATTGAGAGAGAGTGAAGTTAGTGTACAATGTGACTCGCAGGAAGAAAAACCTGACTTACAATCATGTTCATCACTTGCTGTGGACAGCTGTGTAAACTTGTTAAAATATCAGGCGTCCAAAGCTTCATGCCCCTTAGACCTGCTGTCTGCAGAAAGCCTGGGTACAAGGCTGGTAACTATTTGCAGCTCCTCTAGTGAACAGCTGTTGTCAAAGAACCAAGTGGAATCTGTACTCTGTGTTCTGAAGGTGATTAAGCACATGCTGTCAGAGCAATGTTTCAACAGAGTTCACTTTACAAAGCATTTGACCAACAAGGGTCACAGGCTCCCCTTGGAAGTTGTCTGGATGCTTGATAAAAACTGTATAGTGTCCTTCAACACTTACTTGGCATGCTGTCTGCAGCACAGTGAGACTGTTGATATAGTGTCTAGCGGTCTTACTGCACTCTGTTCATGCATCATCAACAAGGAAAAGCAAGAAAATATTTTATCAGATCTTTTGGGAAGATTGGTCACATTTTCCTTTGTTGAAAACAAGACAAAAGAAAAATCCAACAAACTGGAAAAGGTTTCTCAGGAGATTCTGGACGTTGTGGTAGAGAGAAGTGATTTTGTGGCATGCAAGAACATTACAGAATTGTCTTCAAAGAACGACGATTTGAGCAGAGATTGTAAGAGGACTGAAAGATATTCCATGGACTGCAATAAGAAAGTTTTTTCTCAAGACAGCTCAATAGATTTTTTTACATTGCAATCAGATGTTGACAACCTAGCACTGTATCATGCTTTTTGTAATCAAAAGAAGTTGAAGTTCTCAGCACTTCATGAGACAACAAGAACAGTGTTTGAACAGTTTCTTTTAGTCTTTGATCCACCATCTGTTATGGAGACTTTGAAGAATGCATTTTTCAAGGACAAGGTTAATTTAGAAGGTGTCCTTGCATTTCTTTCTGTGTTTGTGGTTCTTGTAAAGGAGGCTGCATCCATGCTTGAAGGTTATGTCAATGATTTGCCCTACATAGCTTGGTTCCAAACCATGTTTGCAGATCAAGGGAATACGAAATTAAACAACAAAAAGAGTGTGCAGTTTTTTGTGAAGTTTCTTTCTGATCTTGTGCCGTATGAGCCTGCTGAATATTTGAAGGTTCATGTCATCAAAGCTCCTCAAGTACCCAGCAAGTTACGTGAACTTGTCACTGACTATGTGTCCTTGGCCAAGACTAGACTTATGGACCTGAAGGAGCCTGTGGAACTGATGGGGATGTATGGGACAGTTCAGGAACATCTGGAACAGAAGCGAAAACAACTTGAACAGGCCACTGCGGATGTCGAAAAGGTTCTTGGTTCATATGAGAAATCGGGGAAGGTCCCCAGTACTGTTATGGAAGCAAGTATATTTAGGAAACCATATTTCATTGGGAGATTTCTACCAGCCTTGCTAACTCCCAGAAAGGTCCCAGATGAACCAGATGTTAGAGCTCAGCTCATTGATGTACTAAGCAAAGCTGGTAAAATTCCTAAGAACATGCTGTCTACATATCAATCAGCATGTGAGAAGATCACCACTGAACAGATTGAAGCGAGTTCATCAGATGACGAAGGGACACTAAGTGGAATAGAAAAACTCGTCAAATCTTTAGACAAGTTAACCAAGCTCATCTTAGAATCATTAAAAGCCACTGACGTATCAAAACAATTGGGAAGAATTGCATCTCAGTTGTCAATCATCTCTGCAACTAGCCAATCAATAACAAAGACATGGAATGGAACGCAATTATCCAATCAGCTTGTAGAGATGGATGTCAGAAGCCTGGACAGAAACCAGTTCTGA

Transcript

OS493_005138-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9JL70	Fanconi anemia group A protein homolog OS=Mus musculus OX=10090 GN=Fanca PE=2 SV=2
O15360	Fanconi anemia group A protein OS=Homo sapiens OX=9606 GN=FANCA PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003502 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15865 all species →	Fanconi_A_N	Fanconi anaemia group A protein N terminus	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003516 all species →	Family	Fanconi anaemia group A protein	Interproscan
IPR031729 all species →	Domain	Fanconi anaemia group A protein, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12047 all species →	FANCONI ANEMIA GROUP A PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0036297 all species →	Biological Process	interstrand cross-link repair	Interproscan
GO:0043240 all species →	Cellular Component	Fanconi anaemia nuclear complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_005138-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005138-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

102TPM > 0

7Conditions

23.3Max TPM

2.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	3.09	5.56
polyp at pH7 6	18	15	2.80	5.38
coral polyp · control treatment	16	16	2.93	12.99
coral polyp · oil and dispersant treatment	16	16	2.89	23.33
coral polyp · oil treatment	16	16	2.45	4.90
coral polyp · dispersant treatment	16	14	2.23	5.47
Polyp	10	8	2.28	5.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.56
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.10
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.07
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.72
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.97
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.99
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.90
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.72
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.68
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.60
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.45
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.16
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.91
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.67
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.91
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.17
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.43
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.35
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.68
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.40
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.21
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.82
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.89
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.02
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.89
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.75
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.15
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.06
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.71
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.67
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.59
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.49
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.37
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.36
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.55
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.33
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.44
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.71
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.84
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.77
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.50
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.37
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.89
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.62
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.50
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.34
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.90
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.48
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.35
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.06
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.06
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.25
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.25
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.23
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.95
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.89
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.59
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.26
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.06
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.25
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.47
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.32
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.01
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.19
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.01
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.81
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.41
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.06
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.93
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.87
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.93
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.84
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.74
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.82
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.65
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.21
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.38
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.34
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.