Gene detail

Detailed information of OS493_005365-T1 in Lophelia pertusa

Genomic Location: scaffold_11:708310...720295
NR annotation: KAJ7365266.1, AT-rich interactive domain-containing protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005365-T1

ATGGACAGTTTTATGGAGGAGTTAATAACAAACTCAACCGTATGCCCAGCGTTTATATACTGTTTGTTTTCGATGATGGAGATGACAGAACATTGCGAAGGACTTCTTGTTGTTTGGAAAGGTGGAAGACATTTTAACGAAGGCGAGACCCTTGATCATCTTCCTCTAAAAGATCCTGAGAATTTTTGGTACCCCAGTTGTGCAGGTGAAGAGGTATCAGATGCACATGTGCAACCTAATGGTGAAGAGGCATCAGATGCGTATGTGCATGAGGCCTCAGATCAGATGCACATGTATGCACGACCTAGAGCAGAAGAGCCATCAGATCCGCATGTGCCACTTTGCTCAATGTACAATGATGGGAAGAAAAGGAAAAAGCGAAGGCTGAGTCAGGCAGCAAGCATGGAAGAAACTGAGGCCGAGCAAAAAGAAGAACAAAACCCTGCTCCTGCAAAGAAGAAGTGTTGTCATTGTAGAAAGTGGCTCAAAAAGAAGGAACATGTGGTTTCCGGCTTTGCTGTAGAGAGAGCATTGACATATCTAGACACTGGAAGAATCCCAGGAATCTGGGAGGAGAATTCTTCTGATGTAGTAGTTCATGGAGATAGCGAAGAAGACTCTAAGAAGCTTCATTCGTCAGAAGATGAGAGCAGCGTTGAGGAAGATGAAGAGAAGAAGGCTTTTAGGGAGAAGCTGTTAGCATTCATGGAAGAAAAGGGAACACCAATTATGAGACCACCAGTGTTAGGAAACCAAGATTTAGACCTTCACAAACTTTATAAGATAGTACAAGAGCACGGTGGCATGGAGAAGGTCTCCAATGAACCATTTCTGTGGAGAAAAATTTATCAACAAATGGACATCCCAGTCGTTCCTCCAAGTGCATCACACCACATTAAAATGTCTTACAAGAAATACCTTTACCCTTTTGAAGTTCATGAGAAGGAAGTACTAAAGCCAGTAGCTGAAGAAGAAGAAGAAGAAGAAGAAGAAGTTGATGAACAGAGCCTTGATAAAAATCTCAAACCTGAAAGTCCCAAGAGTCCCCCAGACAGCAGTGATGAAAAAAATCTGGAGTGTTTGGAGCCTCTGCCAGACATGGACGATGATGATGATGAAGTAGTTGTAAAGAAAGCTGAATGTAAACAGAGCACAAGGATCCGAGAAATGAAACGGCAACAAAGTCGGGACTTTGATAATGGTGTGATGAGTGATTCTCAAAGCAAGAGCCCGGAAGAAGATGTTTCTGTAGATGTTGTCAACAGTCCTGAGTCGTCGTCTGATGTGAGCGAGCCGCAGTCTGATAACAGATCTGATGGTCCAGTGGATGAGTTCTCTTTGGAAGTTGGTGAAAAAATCCAAGTAAAGTATGGAAGGGGAAGAAATCACAGGCTTTATGACGCCAAGATCATTCACATTGACCCTGAAGCTAAGGAAGGCACAATTTACTGTATTCACTATGCTGGCTGGAATACTAGGTATGATGAATGGATCAAGCCTGAGAAGATTGCAGGGTGGGGCTCTAGACAGACCAGGAATAGGACAGGCAGTACAAGCAAATTACCGCCTTCAGAACCTGTTGCAAAACCCACTCCTAAGCCAATGACAAGACCGACTGCTAAGCCTGCTGGCAGGCGGACATCGAAATCAGCACCAGCGATACCAGTCAGGGAAATAATTGCTGTTGCTAAGCCTTCGTCAGCGTCAAATGGTGCCAAGAGTGTACTGAAGAGACCCTGCTCTCCTTCCACAAGGTCTGGATCAGTATCACCGTCTCTTGGCAAGTCTCCCAAAACAGGTCCCAGTAGAAGCACGGGGCGCACAAGATCAGATAGGAACTCGCTTTCAGAGATGTCAAATGGATTGGAAGAAGTGAAAAGCCCTTTATCAAGAAGGCGGCAAAAGTCAACTACACCAGAACCATTATTAACCGAGCAACAACAAAACAAATCTGTAGATGCTGTGAACCATGTTTCAACCAATCCCTGA

Transcript

OS493_005365-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2CG63	AT-rich interactive domain-containing protein 4B OS=Mus musculus OX=10090 GN=Arid4b PE=1 SV=1
Q4LE39	AT-rich interactive domain-containing protein 4B OS=Homo sapiens OX=9606 GN=ARID4B PE=1 SV=2
P29374	AT-rich interactive domain-containing protein 4A OS=Homo sapiens OX=9606 GN=ARID4A PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006047 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11717 all species →	Tudor-knot	RNA binding activity-knot of a chromodomain	Family	Interproscan
PF01388 all species →	ARID	ARID/BRIGHT DNA binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR025995 all species →	Domain	RNA binding activity-knot of a chromodomain	Interproscan
IPR036431 all species →	Homologous_superfamily	ARID DNA-binding domain superfamily	Interproscan
IPR001606 all species →	Domain	ARID DNA-binding domain	Interproscan
IPR051232 all species →	Family	AT-rich Interactive Domain/SWI1 Chromatin Remodeling	Interproscan
IPR016197 all species →	Homologous_superfamily	Chromo-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13964 all species →	RBP-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0000976 all species →	Molecular Function	transcription cis-regulatory region binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_005365-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005365-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

40.9Max TPM

15.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.04	26.51
polyp at pH7 6	18	18	15.87	22.70
coral polyp · control treatment	16	16	18.97	40.88
coral polyp · oil and dispersant treatment	16	16	18.09	39.69
coral polyp · oil treatment	16	16	15.09	22.43
coral polyp · dispersant treatment	16	16	13.34	22.62
Polyp	10	10	7.34	13.10

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.51
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.18
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.40
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.77
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.38
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.13
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.46
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.93
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.17
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.40
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.40
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.93
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.81
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.29
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.17
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.78
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.93
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.70
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.31
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.38
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.93
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.28
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.24
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.93
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.36
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.04
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.42
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.41
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.27
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.47
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.26
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.41
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.48
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.29
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.72
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.24
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.22
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.34
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.86
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.13
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.11
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.00
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.70
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.43
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.02
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.51
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.69
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.51
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.83
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.43
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.06
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.93
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.01
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.06
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.67
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.93
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.11
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.73
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.01
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.43
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.67
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.09
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.67
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.04
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.46
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.42
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.33
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.33
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.21
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.99
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.88
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.41
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.35
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.54
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.31
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.62
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.50
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.35
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.24
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.77
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.22
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.55
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.32
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.47
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.85
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.93
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.10
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.98
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.19
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.83
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.03
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.30
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.50
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.93

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.