Gene detail

Detailed information of OS493_005469-T1 in Lophelia pertusa

Genomic Location: scaffold_11:1591751...1596558
NR annotation: KAJ7365362.1, hypothetical protein OS493_005469 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005469-T1

ATGCAGTACCTCGCAGCATTTTTGTTCACAGTTTTGATTTACAGCTTAGTTTGTCCTTTTGTAGTTCAAGCAAAGCTGTTTTCAAACTGCACCTTTGAAGAGGTGCTATCTCGGACAAGTGGTCAGAATATGTCGGCTCTACCGTTGACATTCAGTGGACAACTCCCTTCCACAAGAAACGTGAGCCATTCCTGTGTTGTGAAGACGGACAATCGAAACAGTTTGTTGTATTTGAGAGCTAAAAGAAACAAAGAATCAAAAGCAGGAGCCCTGCATGTGTCAGTGTACGGAAAAGATGAGTCATTCCTGGGTCATCTGGACATTTCACAGTCTACAGTTGGTTGGAGCAGTTTGCTTCTCGGTTGCCCATCTCCTTCAGCAACGGACGTCAGGGAAACATATTTAACGTTTTCAGGAACTTCTGGCCTCGTTTTCACAGTGGAATTAATTGAACAAGATGAAGAAGTCAAACTAGATGGACCAACAAAGCCTTTTACATTAAGCTCGGAAAACCCTGTTCGTGTCTTCCAGTTTATCCCCACTGAAGACATCTCACAGACACAACTTGACGTCACTGTTCATAGTACTTCTGACGTGCCAGCATACTTGAAAGTGTCACGTGACTGTAAGGATATCAAGGACAACATAGAACTTGTGGACTACAAGGGTGAGTCAATTCGTCTTTCGTTCGCCAAAAAGGGACGGATTACATTGTCCAAGTTCTCTATTCCTCCTTTGACTGACTCAACTTCCAGCTGGTTTATTGGAATTGCAATTAAGAATGCAACAGGTGACACACCATTTGATGCAACAAAGGTTGTAACTTTAGAACTAGCCAAATCATTTGATTATTCGTACGATGGTCCCTTATTGATCTTATCTCTTCCGATAACAGTCGTATGCGCTTTTCTAATAGCTTCATGGGCCTTGTATTGTTTCAATCATATTAAACCAAGTAAGCTTCACTCACCTGCCCATGTCAACGCTCAAGAAGAAGCTCAACCAATTAGAGTAGTCCAAAATACGAATTTAATTCGTATAAGCTGGAAGGAACTCTTCCCGGCCATGTGGGAAGTTATGTGTAATAACTTTAAAGGGAGGACCACTGGTACGTACTCTTACATCACGGGTATTGTCGGTTCGGTGTTTTTCGTGGGCGCATTTCAGTTTGTATTTGCAGATTGGTATTTAATGATTCAGGAGGGCGACAGAGACCACTGCTATTACAATGACTTTTGTTATAGAGTAAGGTACCGTGATATTCCATACAATTTAATGATCAGTAACTTACCGTATGTATTGCATGGCATAATCTTAGCTCTGACCGTTTGGTACATGGAAGGAGAACTGTTTGCTCGGTGTAAAAAGCTTGCCAAACCGCCCCCAGCTCCACCCAACAACTATGACAGGTTACCCAACCATTTATTAAAATGTCCTAACATTGTTCCTCATCTTGCAAAGATGAATGTTCCCGAACTTGTAATAAATAAGCAAGATGAAAAAGCCAAACAAAAAGCCAAACAACTATACGCAGAGGCGCACAAAAAGAAATTTACTTTTTCTATTGGTTATGCCTTTGCCGTGGCGCTCATCTTTGAGGGTTTGTTTTCCTCGCTTTACCACCTTTGCCCAAGTAAATTGACATTTCAGTTCGATACAGCGTTTATGTTTGTTATTGCAGGTTTGATTGTTCTTATATTATACAATGGCATTGAAATGTCAGAGTGTCCTGCAAGAGGAGAAGCGAAACGTCTTGTGGGGGCAGGAAATTTCTTCCTTTATTTCGTAGTTCCACTTTACATTTTTAATTATTTTGGCTCAATGTATGAAGCAGGGCTGTTTAAGATATTGCAAATACCATTTTTTATAGTCCTGGCAGTTTGGTGCATCCTTATGGCTGGCTGGGCTGGCTATAAAGTGTTTCCTAAAGAATGTTCTAAACCCTGCATAAGCATGGCCAACTTAGCCAAATTATTTGCCTTTCTCTTGGGGGTGGGTGTGCCAACATTTTGCATAGTTTTCTGGAGAAATAATCTTCCACAAGCGTTTTTGTTTACCTGTATTTCAGAATGTATTCTAGTCATTATGTGCAAAGTCGCCAAGAAAGTATGCGGGAAACGCTGTAAAGATTGTTGTGATAGCAAGGAAAGAAACTGCATTCTTTTTACTATGCAAGTGTTGTATGTGCTGGCAACATTAGCTGTTGGGATTTTTGCTGTTAGGTTCTTTGTTTTTATGCCAACAACAGATAAAGTGGAATCTGCCGAAAACTCCCGCAATCTAAACCAAGAATGCGTCTTGTTGGGATTTTTTGACCATCACGATATATGGCATATCCTTTCATCCTTTACATTGCTTATGGGTGCTCATTTGGTAATGTTCATTAGTTATGACCCCCCGGTTAACGAAAATGATACTGAGCACATGGACGAAAATGAAACTGAGCAAATGGAAAGCGGGCGCATGCAATTACGCTGA

Transcript

OS493_005469-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CIF6	SID1 transmembrane family member 2 OS=Mus musculus OX=10090 GN=Sidt2 PE=1 SV=1
D3ZEH5	SID1 transmembrane family member 2 OS=Rattus norvegicus OX=10116 GN=Sidt2 PE=1 SV=2
Q8NBJ9	SID1 transmembrane family member 2 OS=Homo sapiens OX=9606 GN=SIDT2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001213 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13965 all species →	SID-1_RNA_chan	dsRNA-gated channel SID-1	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR025958 all species →	Family	SID1 transmembrane family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12185 all species →	SID1 TRANSMEMBRANE FAMILY MEMEBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003725 all species →	Molecular Function	double-stranded RNA binding	Interproscan
GO:0005764 all species →	Cellular Component	lysosome	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0050658 all species →	Biological Process	RNA transport	Interproscan
GO:0051033 all species →	Molecular Function	RNA transmembrane transporter activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_005469-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005469-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

6.3Max TPM

1.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1.76	4.14
polyp at pH7 6	18	16	1.71	6.33
coral polyp · control treatment	16	16	2.35	5.28
coral polyp · oil and dispersant treatment	16	15	1.17	2.43
coral polyp · oil treatment	16	16	1.29	3.73
coral polyp · dispersant treatment	16	16	1.68	5.74
Polyp	10	9	1.24	2.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.14
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.03
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.37
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.19
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.72
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.64
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.52
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.36
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.20
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.09
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.05
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.95
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.65
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.58
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.58
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.33
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.64
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.57
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.31
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.89
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.45
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.30
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.22
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.91
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.78
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.72
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.57
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.56
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.47
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.28
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.90
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.85
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.15
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.47
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.22
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.01
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.90
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.61
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.99
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.62
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.53
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.41
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.22
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.43
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.93
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.67
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.49
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.27
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.26
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.18
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.06
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.89
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.54
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.46
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.36
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.17
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.73
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.03
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.83
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.61
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.43
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.42
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.17
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.97
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.91
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.64
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.58
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.58
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.39
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.37
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.17
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.87
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.63
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.05
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.03
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.30
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.13
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.48
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.42
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.17
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.67
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.08
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.06
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.92
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.61
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.74
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.65
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.37
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.29
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.