Gene detail

Detailed information of OS493_005522-T1 in Lophelia pertusa

Genomic Location: scaffold_11:2162110...2172072
NR annotation: KAJ7365415.1, hypothetical protein OS493_005522 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005522-T1

ATGTCGTACGTTAAAAGGCTTGCGCTTCATTCGGGCATAATTTGTGCCGTATGGTGCGCTTTTCTACAACAGACCGTCTACGGAGCCGACGCGAAATGCGAATTGAGGACAGATTGTAAACCGGGAATTGTTTTGCCTGTTTGGGGAGGCAGTCCTTCTACTGGCGAAATTGTTGGGCGAGCATTTGTGTACCTACTTGCCTTACTGTTTCTGTTTTTGGGCGTTTCAATAATCTCCGATCGCTTCATGTCAGCCATAGAAATAATCACATCGAAGGAGAAAGAAATACGGATAACAGACAAGAAAACTGGAAAGGAGCGTGTTTTAACCGTGAAAATATGGAATGAAACTGTGTCTAATTTAACTCTGATGGCACTAGGTTCCTCGGCACCAGAAATCTTGCTATCAGCCATTGAAATTGTCGGTAATAATTTCGACGCCGGCGAGCTCGGTCCCTCGACAATCGTCGGTTCTGCAGCGTTCAACCTATTGATTATTATTGCAGTGTGTGTTTATGTTATTCCTGATGGAGAGGTCCGCCGCATCAAGCATCTGCGAGTATTTGCTATCACAGCATCCACGTCTGTCCTTGCTTACGTTTGGTTGTACATTATACTAACAATCTCCTCCAAGGATGTAGTGGATGTCTGGGAAGCACTTCTTACTCTGGCCTTCTTTCCCATTATGGTCGGAGCTGCCTACATCGCAGACCGCAGGCTGCTGTTCTACAGAGCACTGCGAAAGAAGCGGAGAAAACAGAAGCGCGGAGGCATGACTGTCATACAAACCGGTGATTTTGATGTTGTTGGTGTCCAAGTCAAGGATGGATTTGTAGACGGAAATGTTGCTGATGGCCGTTACGAACCCGACACCACGGAAGCCGGCGAACAATATGATGACGAGCTTCTTCACGATCTGACAGAAGACAGACGCGAAAAGGCCATCCAAGCACTGAAGGACATACGACAAAAGTACCCCGATGCCGACCGAGAAACCGTTGAACGTCTACTGGAGCAAGAAAATCTCAAACTTCAACCCAAAAGTCGAGCGTTCTACCGAATCGAAGCCACTCGCAAGATGGTCGGCAGTGGAAATGTCTTGAAGATGAAGCACGACAAGCTCGAGAAAGCCAGCAGTTCCTTAGCAGATGCTGCTAGGATGGAGATGCAAGATATCGAGTACGAGGACCCACAGGTCGTCAGGGTTTATTTTGACCCCGTCCACTACATTGTCAAAGAAAACTGTGGAAGTGTGTTTATGAACATTTCACGCGCCGGTGGTGATCCGAATAACACGGTTTTCGTGGACTTCCGAACGGAAGACGGCACTGCTAATGCCGGCCAGGATTACGAGAAGACCGAGGGCACGATCTGTTTCAGGCCAGGAGAAGCTTCCAAAACATTTTCCGTAGTGGTCATTGACGACGATATCTTCGAAGAAGACGAGCACTTCTATGTACATCTGGGCAACATTCGCGTAGCTGGAGCCGACGGGGATTTGGTGAGAAACACATATCGAGGTCCTGCAGGAAAGGTCGGTAAAGACGGTGTAGCTACGATAACCATCCTGGATGATGACTATCCCGGTATTTTCACGTTCGAAGAGGAAAAGCACTCTGTCACAGAAGCAGATGGATTGCTTAAACTCAAGGTAATTCGCCACACGGGGGCCCGTGGCACCGTTCGTATTCCTTACCATACAGTGGAGGGAACTGCCAAAGGAGGTGGTGAAGACTACGAGGATGCTGTTGGCGAGTTGGAGTTCGAGAACGACGAAACCTGGAAAAACATTGAAGTCCATGTGATAGATGATGAAGAATACGAGAAGAAAGAGATCTTTTATGTTGTTCTTGGGGAACCAAAAGTTATAAAGGATGAAGATGATGACAGTGGTACTGATGTAGATGCTGCTGAAAAAGAACGTCTTGAAGAACTGGGCAAGCCTAGACTAGGTGATATTGGAAAAGCAGAGGTCACCATAATTGAAAGCAGAGAATTCAAGAACACAGTTGACAAATTGCTAGCCAAAGCCAATTTAGCACTGGTTGTTGGTACGTCATCTTGGAAGGAGCAGTTCACTGATGCTCTGACAGTAAGCGGAAGTGGCGATGACGACAATAGTGGCGAGCAATCAACCCCGACCTTTGGTGATTACATGATGCACTACCTGACAGTGTTTTGGAAGCTTTTGTTTGCAATTGTTCCTCCCACTGACATCTGGGGTGGCTGGGCATGCTTTGTTGCCTCTATTGTAATGATTGGCCTGTTAACCATGGTCATAGGAGATGTAGCTTCCCACTTTGGTTGTACTATTGGCTTAGCAGACAGTGTGGTTGCCATTACATTTGTAGCTCTTGGAACAAGTCTTCCAGATACGTTTGCCAGCAAAGTTGCAGCAGTTGGCGATGAGTATGCAGATTCATCCATTGGCAATGTGACTGGTAGCAATTCTGTCAATGTTTTCCTTGGCCTGGGCGTGGCATGGTCTATAGCAGCAATAGTTAAGGCTGTCGATGGAAAACCATTTGTAGTCCCAGCTGGTAATCTTGGCTTCTCTGTGGTAGTTTTCTGTTGTGTAGCTGTAATAGCTATTGCATTCATGATGCTTCGTAGAAATAAAAGGGTCGGGGGAGAGCTAGGGGGTGAAAAGGCATACAAACTTCCCACATCACTTTTCTTCTGTTCCCTTTGGGCTTTATATATTATATTATCTTCTTTACAAACATATTGCCACATCAACGTAGCCATTTAG

Transcript

OS493_005522-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P57103	Sodium/calcium exchanger 3 OS=Homo sapiens OX=9606 GN=SLC8A3 PE=1 SV=2
P70549	Sodium/calcium exchanger 3 OS=Rattus norvegicus OX=10116 GN=Slc8a3 PE=1 SV=1
Q01728	Sodium/calcium exchanger 1 OS=Rattus norvegicus OX=10116 GN=Slc8a1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001922 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01699 all species →	Na_Ca_ex	Sodium/calcium exchanger protein	Family	Interproscan
PF03160 all species →	Calx-beta	Calx-beta domain	Domain	Interproscan
PF16494 all species →	Na_Ca_ex_C	C-terminal extension of sodium/calcium exchanger domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038081 all species →	Homologous_superfamily	CalX-like domain superfamily	Interproscan
IPR004837 all species →	Domain	Sodium/calcium exchanger membrane region	Interproscan
IPR044880 all species →	Homologous_superfamily	NCX, central ion-binding domain superfamily	Interproscan
IPR003644 all species →	Domain	Na-Ca exchanger/integrin-beta4	Interproscan
IPR004836 all species →	Family	Sodium/calcium exchanger protein	Interproscan
IPR032452 all species →	Domain	Sodium/calcium exchanger domain, C-terminal extension	Interproscan
IPR051171 all species →	Family	Calcium/Cation Antiporter	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11878 all species →	SODIUM/CALCIUM EXCHANGER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0007154 all species →	Biological Process	cell communication	Interproscan
GO:0005432 all species →	Molecular Function	calcium:sodium antiporter activity	Interproscan
GO:0006816 all species →	Biological Process	calcium ion transport	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015491 all species →	Molecular Function	obsolete cation:cation antiporter activity	Interproscan
GO:0030001 all species →	Biological Process	metal ion transport	Interproscan
GO:0030424 all species →	Cellular Component	axon	Interproscan
GO:0035725 all species →	Biological Process	sodium ion transmembrane transport	Interproscan
GO:0042383 all species →	Cellular Component	sarcolemma	Interproscan
GO:0098703 all species →	Biological Process	calcium ion import across plasma membrane	Interproscan
GO:0098794 all species →	Cellular Component	postsynapse	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05849	SLC8A, NCX; solute carrier family 8 (sodium/calcium exchanger)	-	Glycosaminoglycan binding proteins	ko00536	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005522-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

37.8Max TPM

15.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.71	33.18
polyp at pH7 6	18	18	15.01	31.86
coral polyp · control treatment	16	16	20.14	33.39
coral polyp · oil and dispersant treatment	16	16	14.50	29.97
coral polyp · oil treatment	16	16	16.06	31.03
coral polyp · dispersant treatment	16	16	16.39	37.78
Polyp	10	10	6.23	15.65

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.18
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.21
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.35
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.09
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.85
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.29
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.70
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.87
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.68
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.44
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.52
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.47
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.37
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.34
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.40
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.13
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.10
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.74
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.86
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.12
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.63
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.81
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.10
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.75
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.42
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.01
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.92
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.47
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.48
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.74
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.39
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.16
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.92
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.99
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.32
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.39
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.19
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.61
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.68
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.13
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.95
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.04
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.61
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.57
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.04
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.37
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.86
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.64
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.97
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.34
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.90
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.58
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.31
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.20
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.73
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.53
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.06
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.42
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.37
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.52
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.67
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.59
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.35
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.03
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.59
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.35
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.29
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.30
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.28
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.21
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.42
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.36
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.90
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.30
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.40
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.47
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.22
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.78
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.66
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.55
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.95
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.81
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.38
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.39
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.88
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.36
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.01
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.67
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.63
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.65
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.16
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.21
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.03
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.71
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.69
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.64
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.62
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.53
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.01

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.