Gene detail

Detailed information of OS493_005579-T1 in Lophelia pertusa

Genomic Location: scaffold_11:2816095...2832033
NR annotation: KAJ7365471.1, hypothetical protein OS493_005579 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005579-T1

ATGGCGGGTAACACAAATTGTGGCCTTTTTGCCATCTACAACTGTGTAGTAATGTATACTCTTGTAAATAGAGATGAAGGTAGTTCAGTGTATAATTATATCAAAGATCTGTTGTTAAAAGGATCACTGGAGGAGAAAGGAAAATGGACACAAGCCCAACAAGATTACCAGCGATTCAATTTGATGTTTGGTGAAAGGAAGGGAATCGGACTATACAAGAATAGACTTGTTCGATCATTAGCCGAGAGTGAAGCTGAAATGTATCACTGGATGCCTGTTTCTTTCATCATTTTACCAAAACAAGTGAGATCAAAATCTGAGTCAAGAAGAAAATTTAATGTGAAATATGCTGATGAGAGAGACGATCTGATGGCCTTTTCAAAGAGCCTTGATAAGAAAGTTTGGATAGCAAAGTCATCATCTGGAGCAAAAGGGAAGAACATTTTCATTTCTGACGACATTGAAGCCATCCTGGTCTTTGTTGATGAGCAGACACAGGGTTTTGTTGTACAAAAGTACATCGAAGACCCTATGTTACTGGATAAAAATAGAAAATTTGACATAAGGTGTTGGGTGCTAGTGGATCATAAATACAACATTTATATTTTCTCAGAGGGAGTGCTGAGAACTTCATCTGAACCATACGATGCTAATGACCTTAAAAATATTACTAGTCATCTGACAAACCACTGTATACAGGAGGAACACTCTGGAAATTTTGGACAATATGAAGAAGGAAATGAAATGTTCTTCAATGAGTTTTCAAGGTATCTTGAAGAAGCACACCAGATATCCCTATCAACAGACATTTTACCTCAGATAAACTTCATTGTTAAGAAATGTCTGCTTGGACTCAAAGAGGAATTGACAACAGACGGTCTAGGATATCACAGTTTTCAGCTTTTTGGATTTGACTTCATGGTTGATGCAGAGTTCCGTGTGTGGCTACTGGAAGTAAATGGTGCACCTGCTTGTGCTAAGGTATTGTTGCCATCCCTGGCTCAAGATCTTGTGCGAAAAGCTATTGACCCAATCTTCCCTACAGACGGCAGCAAGGAGCCTTGTGAAAGCTGTCAATCAGAGAGAGCAGTGCCATGTGAGGATCATCACCCAAGATGTGGTCACTGGGCATCGAAAGATGAATGCAAGAAAAATGTCAAGTGGATGTCAAAGCACTGCCGACTTAGCTGTGGCTACTGTGCTCAAGCCAATGTTCACGATCTTTATAAACAAGCCAAAGTGGAGACACATGGAGGCTTATATCTGCTTATCGGCATTGTCATCGTAGTTGTAGCAGGGACGTTCATCAGGATATACTTTGAAGGACCATCCTGTCCAAGCCATGCCAAAATGACAGGTAAAACTGTGGTGATAACAGGTGGAAACACTGGTATTGGTAAGGAAACGGCACGAATCCTAGCATGGAGAAAGGCAAGAGTGATCATCGGCTGTCGAAACATCACAAAGGGATTACAAGCTGCTGCGGACATCATAGAAAACACTGGGAATAGAAAAGTGGAAGTGAAAAAATTGGACTTGTCTTCTTTCAATTCAGTACGAAAATTTGCAGAAGAGATTAACGAAGAAGAAGAAAGGGTGGATGTCTTGATAAATAATGCCGGTTACTTAGGACCATTTCTGTCAACAGTTGATGGACTCGAAAACACTATTCAAGTGAACCATCTGAGTCATTTCTTATTGTCTCATCTTCTACTTGATAAGCTAAAGGCCTGTTCACCAAGCCGCATTATTAATGTGTCCTCTAGGCAGCATTCTGAGGTGTCGCACTTTGATATCAACAAGGTCTTGTCACAAACGAAGGAGGATTATGGAATGTTCAAAGTCTATAACAACAGTAAACTGTGCCAGATCCTTTCCACCTTGGAGATGAGCAAGAGAATAAAAGGATCAGGAGTAACAGTGAATGCCCTTCATCCTGGAGTTGTGCAAACTGAAATTACGCGCAATTTCCGGCTTCTGCAAATGTGGATTATCAGGCCACTTCTTTGGTTTGTGATGTATTTCTTTTTTAAGACGGCAAACAGCGGCGCCCAGACATCAGTATATTGTGCAGTTGCGGAGGAATTGAAGGATGTTTCTGGGGAATATTTCAAGGATTGTGCATCAACCAAGTGCAGTACTTTGGGTAAAGATGAAACTTTAGCTGACGAGCTATGGAAACAAAGTGAACAGCTCACTGGAATAAACAAAGACTGA

Transcript

OS493_005579-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NG68	Tubulin--tyrosine ligase OS=Homo sapiens OX=9606 GN=TTL PE=1 SV=2
P38160	Tubulin--tyrosine ligase OS=Sus scrofa OX=9823 GN=TTL PE=1 SV=1
P38584	Tubulin--tyrosine ligase OS=Bos taurus OX=9913 GN=TTL PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009745 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03133 all species →	TTL	Tubulin-tyrosine ligase family	Family	Interproscan
PF00106 all species →	adh_short	short chain dehydrogenase	Domain	Interproscan
PF01549 all species →	ShK	ShK domain-like	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004344 all species →	Family	Tubulin-tyrosine ligase/Tubulin polyglutamylase	Interproscan
IPR003582 all species →	Domain	ShKT domain	Interproscan
IPR002347 all species →	Family	Short-chain dehydrogenase/reductase SDR	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR052492 all species →	Family	Tubulin--tyrosine ligase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46570 all species →	TUBULIN--TYROSINE LIGASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0036211 all species →	Biological Process	protein modification process	Interproscan
GO:0000226 all species →	Biological Process	microtubule cytoskeleton organization	Interproscan
GO:0004835 all species →	Molecular Function	tubulin-tyrosine ligase activity	Interproscan
GO:0005876 all species →	Cellular Component	spindle microtubule	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_005579-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005579-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

41.1Max TPM

9.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.16	15.45
polyp at pH7 6	18	18	6.22	10.67
coral polyp · control treatment	16	16	11.46	35.03
coral polyp · oil and dispersant treatment	16	16	8.87	22.34
coral polyp · oil treatment	16	16	11.10	35.90
coral polyp · dispersant treatment	16	16	7.60	28.04
Polyp	10	10	14.22	41.15

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.45
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.72
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.35
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.02
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.34
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.87
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.84
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.47
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.37
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.10
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.48
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.22
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.85
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.20
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.57
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.49
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.36
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.24
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.10
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.61
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.60
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.41
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.60
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.55
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.69
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.46
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.19
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.14
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.57
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.03
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.74
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.87
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.28
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.38
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.15
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.50
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.37
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.29
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.97
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.92
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.55
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.34
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.61
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.57
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.94
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.71
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.35
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.96
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.29
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.14
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.47
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.72
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.90
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.53
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.43
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.43
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.18
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.27
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.20
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.19
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.15
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.15
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.08
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.90
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.90
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.15
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.87
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.04
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.34
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.99
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.72
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.23
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.09
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.76
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.99
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.07
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.98
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.98
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.97
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.68
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.35
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.06
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	41.15
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	37.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.63
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.88
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.60
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.22
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.14
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.41
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.60
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.66

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.