Gene detail

Detailed information of OS493_005616-T1 in Lophelia pertusa

Genomic Location: scaffold_11:3194281...3203034
NR annotation: KAJ7365507.1, von Willebrand factor A domain-containing protein 5A [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005616-T1

ATGAATGGAAGGTTCGGGCTCGTACAAAAACAAAATGGCACCGGAGTTCCTTTGGAAAGCATCAATCTGCAAGTTGATGTGCAGGGATTTACAGCACATGTGTTGGCGACCATGAAATACACGAACAAGGATGAAAATCCTATCGAAGCCATTTACATTTTCCCGTTGGATGAACAATCTGCCGTGTGCGGATTTCAAGCGACAATCGACGGTCGAACCATCGTCGCAGAAATACAGGAGAAGCAAGAAGCTCGAGATACCTACGACGATGCTATTAGCAGCGGCCAGAGCGCTTTTCTGTTGGAAGAAAGCGACGAAAGCTCGGATATTTTCCAGATAAGCGTTGGAAATTTACCGCCCAAGACAGAAGCAATCGTAGAGCTGCGTTTTGTAACAGAGCTTGCTGTTGAGAGTGAAGGTCGAGTCGTGTTCGCCCTACCAACAGTTTTGAATCCCAGGTTCTCTCCGCAAGACAGTGCAGCAAGCCTCAGCACCCAAATTCCACGAGCTGCCGTGGTCGATTCGCCTTACTTGTTCGAGTTTGAGATGAGAGTGAAAGCCATCTCCGCCATCAGCGAGATTACTTCCTCGTCCAACGCCCTAAAGGTCGAGATAGACGAGGACGATCGAAGTCAAGCCAAAGTAACTCTGGCAGAAGCCCACAAGTTCAACAAAGATGTTGTGGTTCACATTTTGACGCGCGAACCTTTCAAACCGCAAGCGATTGTGGAAGATGGAGTGAAAATAGAAGGAAAGGAAGATAAAGAAGGTTTTATGGCAAGCCCTGTTGTCATGCTGAATTTCTTCCCAGAATTTAAAAGCTCAGAATCGTCGGATAAAGGCGAGTTTGTGTTCGTGGTTGATCGCAGTGGAAGTATGAGTGGGAGCAACAACAACAGCGCCAAAGAAACGCTGCTTCTATTCCTCAAGAGTCTGCCAGATGGTTGTTATTTTAATGTGGTGGGGTTTGGAAGCAGCTACCAGACTCTGTTCAAAAGCAGCCAACTGTACAATGATAAGAACGTGGAGAAAGCTACTGATCTGGCAGAGTCCATGCAAGCTGATCTGGGTGGTACAGAAATCCTGGCCCCTTTGGAGTGGGTGTTCTCTCAGCCCCTCGTCAAAGGTCACCCAAGACAGCTGTTCCTTTTGACAGATGGTGAGGTTGGCAACACTCAACAGGTGATAGATTTGGTGCAAAAGCACTCCGCAACCGTAAGATGTTTTACATTTGGCATCGGATCAGGAGCATCCACTGCACTGGTGAAAGGTGTGGCTAGAGCTGGGAAGGGTACAGCAGAGTTTGTTACTGCTCAGGAAGATCGGCTACAGGCTAAGGTTATCAAGACTTTAAAGAGTGCTCTTCAACCAGTCATATCAGATGTAAACGTAGCCTGGGACCTAGCAAAAGGCTGGACTGTGCACCAGATCCCTTCATCTCTCCCTCCGCTCTTCAGTGGAGACAGACTAGTGGTGTATGGTGTTCTCAACGCTTCACAAAATGCAAATGAAGGTGGTCACAATCAAGTGAGGCTGCAAGGAATGTTTGGAAATGACGAGAAAATGGATCATGCGATTACCTTTTCAACTCCACTTACAACAAACACAAGGGACATTGGTCTTGGAACGAAAGGAAATGTCCTTGTTCATCAGCTAGCAGCCAAGAGTTTGATTCAAGTGAAACAAGATGACCACAGTGAAACACGCAGCAGTGGGAAAGGGTTTGAAGAAGCCAAAACCTCCATTATCAGCATCAGCAAATCAGCTAATGTAGTTTCAAAGTTCACCTCGTTTGTAGCTGTTGATAAAGACAGTAATCAGCCTGTATCTGGACCATTAAGAAAACATGTCGTACGTATACCTTCATATGGATGCATGGGCCCGCAAGCTATGTGTTACAGTATGCCCACGTCAATGTGCGTAACAAAGGCAAAGGGTGGTTTCCCATTGAAGAGCAGAAAGAAAGCAGTACCAGACGAACATGTACTTGGAGCATCACTGGCACCATCGAGTGCACCCAAGGCTAAGTCGAAAGGATTCTTCTCTTTACCATCACTGTTCGGATTTTCAACAAAGGCACCACCACCAGCAGCCGCTTCAGTTTCCATGGCAGCAGGGCGACCTCCTGTTTACGCGATATTAGATTTCGACGATACCGATGAGTCGTCTGACGACGAATCACTCAGGCGACACAACGACAAATCATTTGCTAAGAACTTGTCTGATCAATTTATGAATGCATCTCCCCTGCTCTATGGCTGCCCTCCTCCAGCTCCCGCTCAATCACAGAAGAAGAAAGATGGACCAGCAGTCTTGCAACTTATAATGTTACAAAAAGCGTCAGGGTCATGGGAGCTCACAGACCAGCTGGTGTCACTCTGTGGTGCAAGCAGAGATGCTTTGATCAAAGGATGCCCAAAAGAGATATCAGTTGATACAAGTGAAGGAAAGTTGTTGTGGGCCACTGCCCTGGCTCTGGTGCTGTTGATGGGCAAGTTCTTGGATCAGAAGGATGAATGGGAAATGATTGCTGAAAAGGCAACAAGTGGATGA

Transcript

OS493_005616-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q99KC8	von Willebrand factor A domain-containing protein 5A OS=Mus musculus OX=10090 GN=Vwa5a PE=1 SV=2
Q75WE7	von Willebrand factor A domain-containing protein 5A OS=Rattus norvegicus OX=10116 GN=Vwa5a PE=2 SV=1
O00534	von Willebrand factor A domain-containing protein 5A OS=Homo sapiens OX=9606 GN=VWA5A PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001087 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08487 all species →	VIT	Vault protein inter-alpha-trypsin domain	Family	Interproscan
PF13768 all species →	VWA_3	von Willebrand factor type A domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013694 all species →	Domain	VIT domain	Interproscan
IPR002035 all species →	Domain	von Willebrand factor, type A	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45737 all species →	VON WILLEBRAND FACTOR A DOMAIN-CONTAINING PROTEIN 5A	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_005616-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24510	VWA5; von Willebrand factor A domain-containing protein 5	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005616-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

836.3Max TPM

76.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	10.95	16.37
polyp at pH7 6	18	18	12.07	18.91
coral polyp · control treatment	16	16	44.61	74.28
coral polyp · oil and dispersant treatment	16	16	114.89	331.13
coral polyp · oil treatment	16	16	32.11	100.88
coral polyp · dispersant treatment	16	16	301.80	836.33
Polyp	10	10	7.58	11.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.37
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.22
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.85
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.72
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.23
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.93
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.92
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.50
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.43
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.08
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.84
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.76
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.32
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.12
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.90
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.86
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.91
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.34
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.04
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.51
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.51
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.43
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.27
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.02
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.97
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.95
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.42
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.95
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.54
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.04
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.21
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.06
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.28
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.89
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.65
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.51
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.13
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.74
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.51
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.45
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.99
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.56
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.59
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.24
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.78
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.33
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	331.13
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	299.09
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	171.66
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	169.60
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	142.65
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	136.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	123.74
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.77
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.93
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.12
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.29
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.77
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.62
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.30
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.06
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.33
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.64
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.01
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.67
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.03
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.86
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.75
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.50
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.99
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.58
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.71
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.45
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.13
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	836.33
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	691.89
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	670.78
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	624.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	419.12
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	247.31
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	231.91
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	219.47
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	191.24
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	160.49
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	152.72
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	132.31
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	130.86
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	88.42
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.44
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	11.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.20
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.84
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.56
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.89
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.42
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.07
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.73
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.16
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.18

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.