Gene detail

Detailed information of OS493_005622-T1 in Lophelia pertusa

Genomic Location: scaffold_11:3257594...3278868
NR annotation: KAJ7365513.1, hypothetical protein OS493_005622 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005622-T1

ATGTCCAGTGCTACCTCCAGCGGACAGACACAGAAATCCTATGGAATTACTTCCCCGATATCTTTGGCCGGACCCAAGCCCGGGGACATAACATTTACAAAGGCCCTTGAGGAATCTCTCAAACCTTATGGAGTATTTGAATCTGAGGAAGAGCTCCAGCACAGGATAGTTGTCCTTGGAAAGCTTAATGCCTTGGTCAAGCAGTGGATCATTGATACTAGTTTATCAAAGCACATGCCAGAATCTGTAGCGAACACGGTAGGAGGAAAGATCTTCACATTTGGCTCATACAGACTGGGCGTACATACCAAAGGTGCTGATATTGACACGCTGCTTGTCGCTCCTCGCCATGTTAATCGTGCTGACTTCTTTGGAACATTTTACGAGATCCTCAAGAACAATGAAGATGTGAAGGAATTAAGGGCAGTGGAAAATGCATTTGTTCCTGTGATCAAGTTGGTATTTTGCCAGATAGAGATGGACTTGTTGTTTGCAAGATTAGCTCTGCCTGAGGTGCCAGATGACTTGAGTCTTTTAGATGAGAACTTGCTTAAAAACTTGGATCCAAAGTGTGTTAGAAGTTTAAATGGTTGTCGCGTCACAGATGAAATTCTGCACTTAGTTCCCAACATAGAAAACTTCCGGCTTACACTGAGAGCAGTCAAGTTGTGGGCAAAAAATCGTGGGATCTACTCCAATGTATTAGGTTTCCTTGGTGGTGTATCCTGGGCCATGTTGGTGGCTCGCACGTGTCAGTTGTATCCAAATGCTTTGGCAGCTACGCTACTCCAAAAATTCTTCCTTGTGTTTTCAAAATGGGAGTGGCCAAACCCTGTGCTGCTAAAGAACATCACTCCTCCCAGTGACAACAAACTGGGATTTAATTTTCCAGTGTGGGACCCAAGGACAAATCCAGCAGACCGATATCACTTGATGCCAATCATTACACCAGCTTATCCACAGCAGAATTCTACATTCAATGTCTCTATGACAACAAGAACCATTATGAATGAAGAATTTGAAAATGGGTTAAGAATTACGAGTGACGTTTTGATTGGCAAGTCAACCTGGACGTGCTGTTTCAACCACCCAACTTCTTTAGCAAATACAACCCTGCCAGCTTCATTTATTGCTGGTGAATTCTGTTCTCCACATTTCAGACATTATATCGTGTTAAGTGCCCTGTCAAACTGTGAAGAGGATCATCTAGAGTGGATTGGTTTAGTCGAGTCAAAGATCAGGATACTGATATCAAACCTGGAAAACACTCAGTATGTCTTGCTAGCTCACGTCAAACCAAAATCCTTTGGTGCATTAGAACCAGACAAGGAAGCACCCATTACTAGATGGTTTATTGGATTACAGTTTGAGAAAAAAGAAAACGTAAAGATAGATTTGACAGGAGCAATTCAGATGTTTACTAATACTGTCCATTCACAAGCCTTAGCAGCCAAAATGTTCAAGGAGGGCATGAAAACAGAAGCCAAACACGTCAAAAAGAAGCAGCTCAGTGAATATCTACCACCAAGTGTTCTAAAACAGAAGAAGAAAAGCTCCATAGTCCCATCTGCCCCAGCAGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTGTAAAGCCAGAAGCTAAAGCAGACATGTCTCTTGATTCAACGCTGAATGCTAGTGACCTGAGCCTGGAGATTACTTCAGAGCCTAGTAATGAAAGTGTAGACTTGACTGGAAGCAGTGAAAACAGCGAGGAAATAACTGCTGTTAGTAGTTCAGACGACAAAAAAGTCAATGCAGACACCACCGTGACGTCATCTGTTTCAACCATTGGTGAAGTGACATCATCAGATACAACTGCGATTCCAAGTCAGCCGTCAGCGGCTTCACAAGACAAGCCCGCCGGGTTAAAGAGAGCTGGTTCTCCTTCAGAAGTGGAAAAGGCCAGCAAGAAACGTCGAATGGACGATGCGGAAACCACGGTGGCTAGTTCGGCTAATTCGCTTAATGGTGATCGTGGAAAGAAACGGCCAACTTCGGCTGCTGCTAACGAAATTCCACAGAAAAAGGTTAAAATGGAAGATGAGCCGGACCAAAGCAAAATGTCTGGCGATTCTTCTAACGTAGGAGATAAAAGTATCGTAGATGGAGAAAAACGCATCCAAAGTGAGGTAAAGATCGAAAGCGACACCCAGGGCTCTTCAACGGGTGAAAACTGCACAAAGACAGGAGACGGCAAAATTGATAACCTGGTTGATACCAGCAAGCCTGAGGAATCAAAGAGCATTGTATCTGGTGCCGTCAAACGATCGATATCTCCAACAAACGAGGAGAAAAACAAAAAGATGAAACAAGACCAACTCCATGCTGCGAACGCGGATCTTGAAAAAGAGCTTATCGAGGAGGACCCACCCCCTGCAAACCAGATTCCCGTGATTAAAAACGCCATCAAAATAAAGCTCAAGTAA

Transcript

OS493_005622-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P25500	Poly(A) polymerase alpha OS=Bos taurus OX=9913 GN=PAPOLA PE=1 SV=3
P51003	Poly(A) polymerase alpha OS=Homo sapiens OX=9606 GN=PAPOLA PE=1 SV=4
Q61183	Poly(A) polymerase alpha OS=Mus musculus OX=10090 GN=Papola PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001969 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20750 all species →	PAP_NTPase	Poly(A) polymerase nucleotidyltransferase domain	Domain	Interproscan
PF04928 all species →	PAP_central	Poly(A) polymerase central domain	Domain	Interproscan
PF04926 all species →	PAP_RNA-bind	Poly(A) polymerase predicted RNA binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR043519 all species →	Homologous_superfamily	Nucleotidyltransferase superfamily	Interproscan
IPR048840 all species →	Domain	Poly(A) polymerase, nucleotidyltransferase domain	Interproscan
IPR007012 all species →	Domain	Poly(A) polymerase, central domain	Interproscan
IPR007010 all species →	Domain	Poly(A) polymerase, RNA-binding domain	Interproscan
IPR014492 all species →	Family	Poly(A) polymerase	Interproscan
IPR011068 all species →	Homologous_superfamily	Nucleotidyltransferase, class I-like, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10682 all species →	POLY A POLYMERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004652 all species →	Molecular Function	obsolete polynucleotide adenylyltransferase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006378 all species →	Biological Process	obsolete mRNA polyadenylation	Interproscan
GO:1990817 all species →	Molecular Function	poly(A) RNA polymerase activity	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0016779 all species →	Molecular Function	nucleotidyltransferase activity	Interproscan
GO:0031123 all species →	Biological Process	RNA 3'-end processing	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14376	PAP; poly(A) polymerase	EC:2.7.7.19	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005622-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

85.9Max TPM

31.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	29.94	38.71
polyp at pH7 6	18	18	33.37	49.97
coral polyp · control treatment	16	16	35.95	85.89
coral polyp · oil and dispersant treatment	16	16	33.42	73.74
coral polyp · oil treatment	16	16	32.00	45.36
coral polyp · dispersant treatment	16	16	20.15	34.84
Polyp	10	10	32.11	45.30

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.71
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.79
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.40
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.73
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.87
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.77
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.28
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.54
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.36
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.26
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.04
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.94
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.44
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.73
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.44
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.66
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.69
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.61
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.27
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.47
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.16
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.18
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.72
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.46
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.54
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.82
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.68
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.39
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.16
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.88
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.52
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.89
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.83
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.78
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.42
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.62
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.96
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.22
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.80
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.83
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.79
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.17
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.13
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.60
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.82
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.32
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.74
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.26
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.71
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.17
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.40
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.09
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.05
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.91
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.49
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.64
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.79
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.64
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.85
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.58
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.30
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.39
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.47
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.39
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.11
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.91
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.33
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.78
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.99
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.11
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.28
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.22
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.82
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.90
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.84
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.26
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.65
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.76
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.10
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.05
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.91
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.30
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.39
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.21
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.69
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.63
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.50
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.92
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.51
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.74
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	45.30
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	42.58
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	34.16
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	33.55
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	32.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	30.94
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	29.45
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	26.45
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	24.57
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	21.39

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.