Gene detail

Detailed information of OS493_005686-T1 in Lophelia pertusa

Genomic Location: scaffold_11:4150929...4180727
NR annotation: KAJ7365571.1, hypothetical protein OS493_005686 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005686-T1

ATGGCGGACAAACAGACCAAGCTTGCAAAGAGAAAAAATAAATTTAATTCAAAAGATGGCCATGATTTGTCGCTGGAGGATGTTCTTGCGGTCGGAGGAGACAAGGATGACTTTGAAATGATGAAGGACGTAGATGTATCAGGTGATTTTGTTGCTGTTGAAGAGACTTCAGAAAACATAGAAGAAAAGGAGATAATGTCATACATCAGAGATCTTGGTTTGGATAAAATCTCCTTTAAAGGCAAAGCTGAACTGAACGAGAGTGCTGCCAAAGAAGAAAACAGAACAAACATTTTGCCAAAAACTGGAGAAATTCAAAAGAAGGATCAAGCAGAAAAAGAACACAAGAAAGGGAAGAAAGAAAATAAGTTCAAATCAAAAGATGCCGAGAAAGCATTGGAGTCGACAGAATCCAAAATGACTGCACAGGAACCCCAAGTGTTACCAGAAAGAAAAGGAGGTCCATACCAAAAGCTGCTGATTAAACCTGGTGGCCTGTGGTATGATCTGGTTGAGGAAGAGAAAAACTCGTACCCCTCCCCTAGTCAAGCTGATATTGTTCAGCTTTCTAAAGAAGCAGCTGATCTTCTGGAGAATGAAGTTATAATCTATGATAAAATGAAAGCTAAAGAGAAGTCATCGGATTCACAGTGGTTAAGATCTGTTGTAAGTTCAGGAACATTGAACGACAAAGTAGCTGCTCTTACTGTTCAAGTACAGGAGTCTGCCATTCATCGGCTGAAAATCTTGGACATGTTAATTGGCATGGCCAAAAAGAAGGGGAGAAGAGAAAGCATTATAGCTGTTGACATGTTGAAAGAACTTTGGATGACTTTGTTGCTGCCAGATAATCGGAAACTGAGAAAATTTGTCCAGAATCCTTTAACATCGTTGGTGCCAGTAGTCCATAAAGGAGGTGGCTGGGATGAGCGCGACAGGCGACTTATTCTGTGGCATTTTGAGGAGCTACTAAAACAACGATACAAGGAGTTTATTGAAGTTGTGGAGAAACTTCTTCAAGACACTTTGGTCAACATCAGAAGCAAGATGTTAGGAACAATATTTGATTTGTTGTCAGAGAAACCAGAACAGGAGCAAGTTCTGTTGAGTCTGCTTGTAAACAAGATAGGAGATCCAGACAGAAAAGTGGCTTCAAAAGCAGTTTATCTAACAAGAAGTTTAGTCACTAAGCACCCAAATATGAAACTTGTGGTCACCAAGGAGATTGAGAAACTTCTCTACAGACCCAACATTGCCATCAAGGCTCAATATTTTTCTGTTTGTTTTCTTAATCAGTTGATCCTTACTAAACAAGATAATGAACTTGCCACCAGACTTATTTCTATCTATTTTTCCTTCTTTGGGGCATTCTTAAAGAAGGGAGACATGGAAGCAAAAATGTTGAGTGCTCTCCTCACTGGAGTCAACAGAGCTTTTCCTTTTGCCAAAGAGGAGGACGAGCAGTACAATGAACAAATCAACACTCTGTTCCGTACAGTACATATTGGAACCTTTAATACAAGTGTACAGGCTCTTATGCTATTGTACCAAGTCATGGAATCAAGGCAGTCTGTGTCAGATCGGTTTTATCAGGCGCTCTACGCCAAACTACTTGATCCAAGCTTGAAAACCTCCTCGAAACAGGCTGTCTTCCTGAACGTTTTATACAAGTCTTTGAAAAGTGACCCTTCACTTAATCGTCTTAAGGCGTTTGTCAAGCGTATCTTACAAGTTTGCAGTTTTCAACAGCCGGCGTTTATCTGCGGAACACTATTTATGGTTTCCGAGCTGACAAAACTTAAACCGGCAATCAAGAGTCTTACACAACAGCCAGAGGAAGACGACGAAGAAGAACATTTCGTGGACGTACCCTCGGACGAGGAAAACGACAATAACACGACGACTGAAGATGAACCTCAGACACGCCATGTTGACACACCAAAGGGCCCGACGGCTGGAGCTCATCTCAGTGGTGCTCAGAGAAGCCAAACGTACAAGCCCCAACAGAGAAATCCCTTGTATAGTGGAGCTGAAAACACGTGCTTGTGGGAATTGGACAGGCTCTCCAGACATTACCATCCGTCAGTGTGTCTTTTTGCTTGTACTCTTATGAAGGGTGATGATATTGAATACAAGGGAGATCCTCTACAAGACTTCACCCTCATGAGGTTTCTGGACAGATTTGTGTATAAAAACCCGAAGAGAAAAGAAAGAGATCACGGAGGTTCACTTATGCAGCCGAAAATGTCATCGAGCCGATTGGCAGAGGAGCCTGTGAATACTAAAGCATTCCTTGTGAAGAAGGAAGAGGACATTCGAGAAGACGAGCTGTTCTTTCATAGGTATTTTAAGCAGAAGGCAGAAAAAGAAAATCAACGGAAGAGGAAAACTAGTGATTCTGACGATGAAACGTCAGAAAAGGCAACAAATTTCGACAACATTCAAGAAGAGCGCTCCAGTGTGGAGTTCAACTTCGCTAGTGAATTAAAGAACTCTAAAAAGCCTGGTCCGAGTAAAAATAAAAACAAACCTACCGCTAGTGATGAAGAGGACGAAGGTGACGAAGAAAAACAGAGCGAAAGCGAGAGTGAAGACGAAGACATGGCGGAAAAAGAACAGAATTCATCGGAAGACGAGTTTGATTATGACGCCATCGATTTTTCATCCAACGAGGAAGACGAAACAGAGGAACCAAATAGCTCACATGGCAAGAAAAGAAAACTAACGGAAAAGGATTACGAGAAGGCATTGCTAGAAAATTTGAGCTCTGATGAATTTTCTGACGACGAAAAAAGCCAGAGTACAAAAAAGAAATCTAAAAAAGGCCATATTAAAGGAAGCGACGTTTCATCGATGTTCGCTTCGGCTGAAGAGTTCGCTCATCTGCTGGAGAATTCCAAAGCGTCACGTGGTAGCAGTTATGACGTCAAGAGAGAGGGCGCCAGCGACAAGCAACTGAAATGGGAAGAGAAAAAGGCGGGAAAAAACTGGAATCAAACGAGAGGAGACTGGGGTCGTGGCAGGGGTGGAAGGAAAGGACCGCACAGAGAATCCAATCAGAATCCAAGGAACAAGTTTAACTCGAAAGGCAGAGGCGCGAAAAGGCCGAGATAG

Transcript

OS493_005686-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q03701	CCAAT/enhancer-binding protein zeta OS=Homo sapiens OX=9606 GN=CEBPZ PE=1 SV=3
P53569	CCAAT/enhancer-binding protein zeta OS=Mus musculus OX=10090 GN=Cebpz PE=1 SV=2
G0SEQ5	Ribosome biogenesis protein NOC1 OS=Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719) OX=759272 GN=NOC1 PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004145 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03914 all species →	CBF	CBF/Mak21 family	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR005612 all species →	Domain	CCAAT-binding factor	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR040155 all species →	Family	CEBPZ/Mak21-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12048 all species →	CCAAT-BINDING FACTOR-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14832	MAK21, NOC1, CEBPZ; ribosome biogenesis protein MAK21	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005686-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

18.3Max TPM

7.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.19	10.28
polyp at pH7 6	18	18	10.05	17.61
coral polyp · control treatment	16	16	7.49	12.45
coral polyp · oil and dispersant treatment	16	16	5.28	16.26
coral polyp · oil treatment	16	16	6.67	10.09
coral polyp · dispersant treatment	16	16	5.89	15.43
Polyp	10	10	11.56	18.34

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.28
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.58
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.53
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.38
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.21
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.65
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.59
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.18
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.02
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.98
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.95
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.57
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.35
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.87
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.63
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.56
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.61
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.90
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.38
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.76
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.97
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.34
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.21
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.56
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.28
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.01
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.47
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.52
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.84
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.05
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.45
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.38
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.38
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.17
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.41
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.05
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.85
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.19
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.63
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.52
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.97
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.76
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.75
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.64
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.26
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.74
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.32
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.61
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.95
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.86
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.82
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.77
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.65
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.28
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.21
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.61
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.58
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.91
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.09
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.32
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.29
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.69
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.69
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.62
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.12
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.06
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.92
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.85
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.20
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.02
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.65
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.09
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.43
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.48
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.38
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.16
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.66
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.31
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.96
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.71
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.45
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.29
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.40
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.91
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.83
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.51
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	18.34
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	16.59
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	16.29
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.97
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.86
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.25
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.01
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.93
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.30
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.11

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.