Gene detail

Detailed information of OS493_005737-T1 in Lophelia pertusa

Genomic Location: scaffold_12:310281...318070
NR annotation: KAJ7339344.1, hypothetical protein OS493_005737 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005737-T1

ATGAGATGTGACAGTGCTAGTGAAAATGCTCCTTGCGACGAAGTTTGTTCAACTAGGATTACGAGAAAATCGACTGCATCCAGTACAAGGAGCTGTTCAGCGACAGAGAGATGCAGACAGGAACTGGAAGATTATGATGTTGAGTTTGACGTCAGACCACCAAGTGGTACCAACCATCAGCAACCAGGAAAGCACTTGAGCATAGACACAAGATTTTCAGAGCTAAGCCTTGAAAATTCATCATTGATTGCTGAAAGTGAAAGAGAGCAGCAAAATATACGCAGGCGTGGCACAGGGGGATCCATTTCTGGGAACAGAAATAGACCCAGCAGAGTGCAGATCCCTAAAGGAAATTTTTACATATCTTCGCCCTTTAAACAAGGGCCGGAAAAAGATGTCAAGGGTCCAACATTGGTTGTTGATCCAAGTCTTGATTTGAAGCAGCGGACCATCGCCGGAGTTACGAAGATTAAACGGCAGCTGGACAAGACAAAACGAACAAGAAATTTTAATCTCCCTCAATCACAGTTACAGAGAGGCAACCTCAAGTCTCTTGGGCGGCCTATGACGGCCTCTGGTCCACTCATGAGCAACTGTCAAGGGATTGTAGCTGGTGCGAGAAGTTACCATGGTTTTGCAAGAAGACAGACAAATAATTCACTTGAGGGTGGCAAGCCTTCCAGAGTGTTCTCCGCGTCGGACACTGCATTGGCTGCTGCAGCAAGGCCAGATAGTCCTGATCAGCTGCTGCGCCCGGAAAGCTCAGTCCACAACACTTTGTGTGCATCTTCTATCGACGAGGCCAACAACGACAGCGACTGTAGTTTTTCAGAAGATGAAAGTGAAGACAGCATTGACATAGAGAATCAAGCTGGGATGAAGGATTATAACAAGGATAGTGATCACTCTGAGGAAAAACTCCAGTGCTCGTCAACAGGAAACGGACGTCATTCAAAGCTTGGTAGTAGCTGTAAACCTTATGAAGATACTGAAGGACACCAAGACGATGACAGTGGTAGAGAGGATAGAGATAGAGAAGAGGGTCGATGGGCACAGCAGAACCATCAATCAGTTGGTTGCCATGGAAACCACGGCAATGAAACTCATCCTGGACAGAAGGGAAGCGGCTGCAACGCTAGTACTCCTCAAGGAAAACAAAGGCGTTTAACAAGTAGTGGTGAGGAAGAATACATTCTGACACGAGGTGTCGAGTGTCCAAGCAGCCCTTCATGTTTAGATGCTGGTAAAGTAATCGATGTTCATATCAGTGTGGTCCCTATAAGAGAACACACGACAACACTGGACAGGAAAGGATCTCTTACGCACATTGACGAACGTACGGTAAAACCGCTGCAAGAGTCTGATAGAGATTTTAGTAAAGAGAAAAGTGATGACGATGACTACCTGGATAGTGACGCTTTAGATTCTAACAGAATACCTTCGGCAGACATTTTCAAAGTGCTTGACACTCTGAACCTCAGTACCTCTGCTATAAAGCCCCCGACTCCTAGAGGTGAGAGGTCCAGAGTTCGAAGAGTGCAGTCTGCTGGGTATTCAAGACAAACAGCTGCTGTGATCAGAGATGAGAAGCCTTTTAAGAAAGGTGACAAGTGTTCTAGACCACCTTCAGGTAAACGAGCGGGAAAGAGAAACGAGAAAAATAAGGATTTTCATGATCCCGCGCATTTGAACACCACTACACCTACGCTAATTGGAAGAACGGAAGATTTGACAAAACATGTGAGGCAAACGCTTCCGGGTTATTTTACTGAACAGTACCAAAAAATATTGGACGAACAGAATGAAAATGGCAAAAACACGAACGTGACGAAAACAGATGGAGCTTCATCTAGCAGCTTGGCTTTGGTAGTAAAAGAACTAACAGACGATGATTTGGGTCGTGACGAGAAACTTTACCAAAATGGCCAAACGTCTGTTAATTGTAGAGAGGAAAAAGGATTGTTACAAATGCCTAACGGCAAGCCTGGTAAGAAGAAGACCAAATCGTTGAGCAATGAGCAAGATAAACGTTCAAAAGGTAAAAAGGCTTCGCGGAGCTCAGGGGTGTTCGTGACAATGGACGATAAAAGCGAACTGAGAAGTATTCACGATGTGGAAGACAGCAGTTCTGGTGTGGAAACCATGTCTTGTGTCACGGATTCTTCTTTGGAAAACTATGGCGATACGATAAATCAAAGTAGCTATGACAGTACGCGTGCATACAGAGGTCATGAAGACGTTTATCTTGGGAATGACAGACAAGGGTTTGACGATGACGATGAGTATAGTGATAAAGTTGATGATGATGACGATGATGATGGTGGCGGTGATGAGGGCTATGTGAATGATTCCGATGATGATTTCACCAATTTGGAAGTTGTAGCTAAACCAATGCCTTTGTCCAAGTCCAGATACGTTACAACAAAGAATCCCATTGCTCCATTTCCGCCTCTATGCTTCAACATCAATGCAAAACCTCCCGAGGATCAGTTGTATTACTTCGCTTATGGACCAGAAATGAACCCTAACAGGATGGCTATTTATTTGCGACGAGAGCCAAAAACGCGATTGTGGGCTATTCTGTTTGGATTTCAACTTAGATTTAACAAGAGGGGCACATCTGATGAGGCTGGTGGATTTCCTAATGTAGAATTTAATCCAGAACATTCAGTAGAAGGATGTGTGTACGCCATTACAGATACGGAACTAACCATGCTGGATAATTGCATGGGCTATCCAAAGCATTACACTCGAGTGGTGTTTCCTGTATGGATGCTGAACTGTACCAGTCCCTCTGAACACGGTGTAGCACAGTTCTGTGTACCAGCGGTTTTGTATGTCGCCCAGGACGAGTGGGTCACTCATGATTCGTCTCAGAAGCTGGATTGCCGCTACAGTGTGAGCCAATGTGTGAAAGCTTCTGACATCCTAACTCCAAACTACGTTCAGTTCCTGACTAGCCAGGCCACAAGCTAA

Transcript

OS493_005737-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010032 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06094 all species →	GGACT	Gamma-glutamyl cyclotransferase, AIG2-like	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036568 all species →	Homologous_superfamily	Gamma-glutamyl cyclotransferase-like superfamily	Interproscan
IPR013024 all species →	Domain	Gamma-glutamyl cyclotransferase-like	Interproscan
IPR009288 all species →	Domain	Gamma-glutamylcyclotransferase, AIG2-like domain	Interproscan

PANTHER

No PANTHER signature was detected for OS493_005737-T1. This gene does have a gene model — the search simply returned no hit.

Gene Ontology

No Gene Ontology signature was detected for OS493_005737-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_005737-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005737-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

19.3Max TPM

2.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.09	5.31
polyp at pH7 6	18	18	2.90	5.00
coral polyp · control treatment	16	16	3.84	19.26
coral polyp · oil and dispersant treatment	16	16	2.42	10.41
coral polyp · oil treatment	16	16	2.89	5.09
coral polyp · dispersant treatment	16	16	1.67	3.52
Polyp	10	9	1.97	3.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.31
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.82
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.40
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.34
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.04
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.58
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.34
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.30
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.95
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.61
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.55
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.16
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.94
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.63
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.59
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.33
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.03
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.91
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.77
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.66
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.65
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.74
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.18
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.12
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.84
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.63
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.49
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.39
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.43
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.24
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.06
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.24
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.03
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.52
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.49
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.46
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.15
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.07
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.93
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.51
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.03
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.41
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.69
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.03
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.58
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.53
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.34
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.14
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.38
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.36
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.32
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.15
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.02
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.38
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.09
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.75
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.59
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.58
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.52
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.48
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.45
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.27
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.06
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.71
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.51
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.43
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.89
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.52
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.87
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.54
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.29
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.24
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.90
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.69
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.42
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.31
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.23
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.18
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.06
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.47
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.23
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.10
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.24
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.57
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.50
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.36
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.15
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.92
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.66
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.