Gene detail

Detailed information of OS493_005863-T1 in Lophelia pertusa

Genomic Location: scaffold_12:1830268...1852154
NR annotation: KAJ7339465.1, CDK5 regulatory subunit associated protein 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005863-T1

ATGTCGAGGACATGGCCGACAAACTTGCTGAAGCTGTCCATCTTAATCAACAGTTTAAACGAGAAGCTATTGGAGAGTACTGACGGCTTCCACGAAGATCAACAACAGATGCAAGTTGCTATGAAGGCAACTTTAGATGAGAAAGACAGAATGATAGATGATTTGAGAGGGTCTCTTGCTTCTACCCAGTCAGAAAACAAGGATTTGCAAGATAATCTGGACACCCTGAAGAACATGCTGAGCCATCAAGAACAAAACATCCCCCAGAATACAGCACTAGAAATTAACGAGAAGAAGATCCACGAATCTGAGAGAAGAATCAAACTACTGACAGAAGAACTTGAAACCAGAAACCAGAAATTAGATGAATTAAAGGAGAAAGCCAAGAAAACAGAGAGAACAAACAGGGAATTAAGAAATCAACTCCATGATAAAGAGAGAGAACAGCATTTAAATTCTAGGAATTCAACAGATAATTCACTATCACAGAGTCAAAAGGATGGTCCCAGAGACAATGAGATTCAACAGCTGCACACGAAAGTTCAAGACTTGAATCAGAGTCTGACGGCAACACGAGAAGCAGCACATACTGCCAAGAGGAAGTGGTACCAGGCTTTTGAGGAGCATTCTGAAGTTCTTAAAGCACGAGATGCCATGATAGCTGCTTTACAAAGTTCTATGAGTGCCAAAGATTTGGAATTAGAGAAACTAATCCAGTCCATGTCAGCCAAGGAAGTTGCATTTCAGAGATTAAACAATGGCAAGCTGTTACTGGAACAGCGCTTGGATGAAGTGTTAAAACAAAAAGAACGAGAGCAAGCTGAACTAATGGAAAAGCATAGAGCTCTTTCACAAGAGCACTATTCCAAGATGGATGCTCTAGAAGAAGCTTATCAGCACGTGTCAGCAGGAGCTCAAGACCAACTCGAGATCAAGGACAGACTCATCCAGAAGTTAGCGGCAAACAATAAGGAAAAGGACAACTTACTTGCGGACTTTTTGGAGGCTTTGAGAGGTAGTGGCATGGATGATGACTCAGGGGTCAGGAGCCCGTCTGATCATGAGGATAACCTTTTGAAAAAACTAACAAACTACATGAAAGAGAAAGATCGTGCACTTCAGGTTGCAGTTGAGGAAAAGTTGCGAGCTTTGAAAGGAAAAGAAGCCGAACTACAGCAGTTAAGACAGTCCCTGAGAGAGAGGGACAGGCTGATCGAGAAAATCAACTCTGCAGTACTTGACTCCGAGGAAAACAATAAACTTTTAGAAAGCACAAGCAAAGAGAAGAATGAAGCTTTACAGAGAAAAGCAGCCTCTCTGGAGAATCAGCTGAAAGGACAACAGGGAAATCTGGAGACAAAAGAAGCTGGTTTACAGGAGAAAGAACTTGTTATTCAAAAACTGAAGAACAATTTGGACCACAGAGATGAGGAATTGAAGGAATTAAAGGACTTTGTGAAAAACGCTCTAAGCAGTCCAATAGAGGATGAAGATTTAACTGATGAAGCAAGGAAAGCACAAGAAATATCAGACTTGCTCAAAGAAAAAGAAAAGCTTTGGAGAATGTCATCTGCTCATGAAGCTAACACTCAGAGACTCATGTCAGCTCTTAGAGACAAGGAGACTGCAATGAAGGAGTCTGGTGATGACTTGACACGCGTACAAACCGACAAGAACGCCACCATCCAGACGTTACAACAATTACTGAACAGCAAAGAGCACGAAGTCCAGGCTCTGGAAAACAGCAAAGCTTGGGCGTCCCAGGAACACGACAAGTTAGTGAACAAACTAAAGCTGACCATACAAGACAAGGACAAGACCATTGGAGGTTTAGTAGAAAGCGGACGAGAAAAAGACAAGATGTTGAAAGCATTTCAGGAGTCCAGTAAAAGCCCAACCAAGGCCCCCAGTCCTGCTGAAGTGGCGGGTCTTAGGAGAAATATCAATTTGCTACAAGCTGAAGTACAAAAGAAAGACGAGTCGTTAAAGAGGCTCGAGTCAGACTACAGAACCAATTTGAGGAAACTGCAAGGCGACGATCGAGAGAACAAGTTGAAGTTTGGGAACCTCCAGCATGAAATACAGACAAGAGATGCGTTTATAAAACAAGCAAAGGCTACAATCGAGAATCTTCGTTCAAGGCTACAAAGCATTCCTAATTTAGAGGAGCTTAAACAGAAGTTTGTGGAACAGTCACAGGCTCTGGCCGAGGCTCAGAAAGGAAAAGAACAAGCGCTTGTCGATTCAGCCGCTCTCAAGAAATCTAACTTGGAACTAGAAGCGGAACTGAAGATGAAGCTGAACAACATTGAGATGCTTAATGAGGCTGCGCAGATGAAGGACAGAATCATTAAGGAGATGCAAGAAGATCAACAGAAGCAGCTGAAAGACATGAAGGAAAACATTGGATATTATCAGAAAAAGGCTCAAGAACTCGAGGCCTCAAATAATTTGCTACGGCAACAATTGATGGAGACTGAAGACCTGAAGAATTCACTTGAGAAACAAGTCGAGAGCTACAAGAGGAGGCTCGATAATCAGGCCTCTTACGGAGAGGAAGAGGTGAACCTGCTTCGCCAAGAAGTGAACAATCTGAAGACCAGGCTACAAAGGGCTGGGACACCACGCAGGGAGAGCCCTGGAGTGGGGGCTGGGGCAGAAGAGCAGAGGCTTGATGTCTTTCAGTTACAACAGTTACTAGAAGCTCAGATCTCAGAGACAAAGCGACTTAACGACATCCTGGATACTGAGCATGCGCTGTACAGTAACCTGGTACATGTGGTCCAGGATGCACAGCAAGGAGAGATCAGTCGCGAAACAAACGTCAAAGGTGAGATGCAGGCGTTGAAATCCCTCCGCGCACAACTTGAGGAAGGAATCCGCCTAAACGACTCACTACGGGCTCAACTGCACGACAAACTAGCTTCCAGTAAAGCGCCGAGTCCACATCCAGCATCTCCTTACGACGCCGCGTACCAGAGAGAGATTCAAGAACTCAAATCGAGGCTTGAAGACAGTGAACGCTGGAATGCTTCATTGCAGGCTCGGTTGAATGAGTTGCAGCCGCGGGTCGGTGGTGTCGGGGGCTCGAGTGGTCGAGACAGCGGAGACGGAGGGACGGGGGTTCACCTTCAAGAGTTCAAAGACTAG

Transcript

OS493_005863-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001978 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_005863-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR052593 all species →	Family	Microtubule-associated AKAP9-binding protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46501 all species →	MYOMEGALIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0007098 all species →	Biological Process	centrosome cycle	Interproscan
GO:0060090 all species →	Molecular Function	molecular adaptor activity	Interproscan
GO:0090063 all species →	Biological Process	positive regulation of microtubule nucleation	Interproscan
GO:1903358 all species →	Biological Process	regulation of Golgi organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_005863-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005863-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

20.5Max TPM

9.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.21	14.69
polyp at pH7 6	18	18	8.99	15.11
coral polyp · control treatment	16	16	13.03	20.54
coral polyp · oil and dispersant treatment	16	16	10.46	19.33
coral polyp · oil treatment	16	16	9.78	14.43
coral polyp · dispersant treatment	16	16	9.75	17.99
Polyp	10	9	5.17	12.87

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.69
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.64
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.56
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.30
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.66
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.64
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.08
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.94
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.73
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.22
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.88
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.73
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.87
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.13
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.23
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.11
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.95
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.23
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.19
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.69
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.48
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.15
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.30
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.27
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.17
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.73
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.71
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.20
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.46
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.92
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.54
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.19
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.09
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.56
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.05
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.98
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.80
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.22
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.51
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.03
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.96
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.21
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.44
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.33
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.66
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.37
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.35
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.11
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.66
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.48
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.11
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.68
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.14
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.68
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.33
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.15
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.84
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.43
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.80
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.02
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.87
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.75
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.71
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.70
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.76
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.54
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.13
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.29
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.24
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.13
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.99
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.86
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.54
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.76
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.25
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.09
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.72
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.88
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.77
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.20
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.52
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.48
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.17
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.97
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.87
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.22
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.08
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.53
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.60
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.97
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.57
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.