Gene detail

Detailed information of OS493_005881-T1 in Lophelia pertusa

Genomic Location: scaffold_12:2084943...2099547
NR annotation: KAJ7339483.1, potassium channel, sub T, member 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005881-T1

ATGCCTTTTAAAAAGGGGGATTTAAACAATCCCTCCTTCAAACAAAAGCGCAGGTCAACTAAAATTAGCCCTACAAGTAGTAGAGAAAACAGAGGAAAGCCATTCTCTCCAAGACTGCGAGCGGCCGTTTTACAGCGGATAAAATCAGGAATCGATGTCAACACTGCACTCGCGGACGCTTGTGTCCGAGACAAAAATGCCGCAAAACGCTGGAAAGATCTTTTACAAGACACAGGAAATGTTACTCCATTGAAAAGAAGCGGCGGAAGGCCAAGAAAAGTGGCAAAAGGTTCGCCGGAAGAAAAATTATTAGAGCGACTGGCCGACAAAGACCCTTACTGCAGCACCGAAATAATTGCGTGCCGGCTGCTAAACAGGACTGAAATAGAGATAAGTTCAAGAACTGTCCGCCGCCAACTCTACAAGCGAGCAGATGACAGGTTTAGCTACAAAACACCAAACACGTCCTCCAGTGAAGTTAACTTGGAGCGAGTTCTTGACATGCAGATGGGTTATCTTGATGGCATGCACAGTGCGATCGCTCAGGGCCTGTGTTCTGAAGATGAATTTTACTTCGCGGACGAGTGTCCCATTTTCATCGGTGTTCTGCCTAGAAAAGGCCGTTGTAGAAAAGGCGAACAGCTGTATGGAAGAGCCCCTTATCGGCCCAGAAAGTTCACGCTTCATTCCGCGATTGGTCCAAGAGGATATTACAAAGTTTGGTTGTCCGAAAATAATGCAAACGACGCGGAGGTCAGGCACTTTGTCCTCGACAACATCCGTTCGCCTCAGCATGCTCCTAGCCTTGGCGGTCCACCACTACCATTGACCATCCCACCACACAGTTTTTTCATCTGGGATCGCCTTGGCAGAGCAGGAAGATGTCTTAATCCTTCGAAGCAGCATTACAACCCTGAGATTCACCAACAGTTTCGCCAGGCTAAGATCCAAGTTGTGATGCTTCCACCGAAGGGCCACGAAGCAAATCCGTCCGAGCTGTTTCAAGGCAATATTCAAGCCAGTGTAAAGAGATGGAGAGCCCCTGGTCAAGCAGCCGACGAATCCGGTCCAAGAGACTTTTACGAAGCTCAGAAAGCTGTTTCAGATGCTCTCGACCGGCTGCGTTTCAGCTGCAAAGCCTTCCGTGGCTGGGTTGAGGATGCTGAGGGATGCTTTATACTCACTGACAGATATGCAGATAACAGGGAGGCGGCTGACAAGCACACCATTTTGAGAACATGGGCCATCCAGGACTTTGCTCCAGCCACACCTCTGTACGTACAGATCCTTAAGCCAGAGAACAAGTTCCATGTCAGTTTTGCAGAGCACGTAGTCTGTGAGGATGAAGTCAAACATGCACTCTTGGCTAGTAACTGTGTATGTCCTGGGATCTCAACCTTTTTCACTCTTCTTCTCCATACTCTTCATGAACAGAGTGGATCTGAGGATTGGCATGATATGTATGGCAAGTGTGCAGGAAATGAAATATATGACATCCGCTTGGGTGACAGTAAAATCTTCAGACCATATGCTTACAAGACGTTTACACATGCTGCTTTTCATGCACACAATAAATATGGGGTGACGCTCTTTGCAGTTCGTTCAATTGGGAAAGGTTCACGCATTTTATTAAACCCTGGTCTCTCGCATATAATGAATTATGAGGATCGTTGCTTCTACATTGCTATCTCAAGTGAAGAAGACACCGCATTCAAGGCTTACAAGGAGCCAAAAGAGTCAGTCAGCCTGTTTAAGGGCAGCTTTCGCCACAAGAACGATTCCTTCATCACTGCAAGCTCTGTAGCTCTTGAACTAAAAACGGATGCGGTCGAACCAGTGGGCCTAAAGTTCTTAGATGAGGCACCTGCAAATGGTGTTGGACATGCTAGCTCCAGTGATCAAGAGACTCCAGGCGATCATCAAACTCTGTGTATGTACCTGATGGATCAGATTTTGACGAAGAAGAAACTTCTGAGGCAGGATATGGATTTGCTTGACGACACAAGTAGAATTCCTAGTTACGTGGCAGGAGTTCCACCTTGCTCTTTGTATATTGGTCGTACACCTCTAAGATGCCACCTTCTGAAGAATCCAAAGAAATCTTGTTGTTTAGGACTTAGAAATGAGGCTTGCTTGGACAGAGATCTAAATGACAGTGCTAGATTACATCAGAGGCAGCATGGTGCTATCATTGTGGCATCTCCTGTAGCAGAAGCTGGATTATACAACTTCATTCTTCCTCTGAGAGCTTACCAGCGACCTAAGTGCACCCTTAAACCCATTGTGCTACTTCTCAAAGAAGAACCTAATGAAGATTTCTTAATGGCAGTTTGCCACTTTCCCATGCTGTATTACATGATTGGAACTATAAACAGTCTGGATGACCTTCTCAAAGCTGGTTGTCTTCATGCGGACAGCATAGTGGTGGTAGGCTATCGGTCTCATGGACAGATGTATGATGAGGAACACATGGCAGATGCCAGCACCATAGTAGATGTACAGAGTATTTACAGATGCTTTCCAAGAGCAACTCTGATTGTCGAGCTGACGCATGCCTCCAACATGCGCTTCATGAAGTTTAATGCCGATATGTCTCTTCCCCCTGGAATACAAAGTGAATCATTGGCCAGCTTTAAAACACGAAGCTTCAGAGAGAGCGTCAAGAGGCGAATCAAACAGCAGAACAGGGACCATCTCAACTACATGTTCCGTGAACCCTTTGCCGCTGGTCATGTGTTCAGTATGAGCATGCTGGATACTCTGCTCTATCAGGCATTTGTGAAGGATTACATGATCTACTTGGTTAGATTGCTGTTAGGCTGTGAACAGTCTCCAGGATCAGGATATCTCTCTGCACTGAAAATAACAGAGGATCACATTTGGATTGATACTTATGGAAGACTTTTCCAAAGACTTTGCTCCACCACTTGTGCAGTTCCTATTGGACTCTATCGATCAGAGGTTCCTGAGGATGACTTTACAGATGCATTTCCAAGGAGAAGAAAGAAAGAGATTCGTGAAATCTCAGATATTATAGAGAACAGGATGAAAAATCTGAGTATTTTTGGAACTCCTGACATGACCCAAAGACCAGGCAATTCCTATGTGATAGTTAACCCTAATCCTGAGTTTAAGTTACAAGAAGGAGATGTTATCTACCTGATTCGACCATGTAACACAAACATGTCAGATATAGAAGAGGAACCAACTGATCCAGATGGAGGTGATGACTTGCCCAATACGTCTCTGTGA

Transcript

OS493_005881-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8QFV0	Potassium channel subfamily T member 1 OS=Gallus gallus OX=9031 GN=KCNT1 PE=1 SV=1
Q5JUK3	Potassium channel subfamily T member 1 OS=Homo sapiens OX=9606 GN=KCNT1 PE=1 SV=2
Q9Z258	Potassium channel subfamily T member 1 OS=Rattus norvegicus OX=10116 GN=Kcnt1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002912 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03493 all species →	BK_channel_a	Calcium-activated BK potassium channel alpha subunit	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR047871 all species →	Family	Calcium-activated potassium channel slowpoke-like	Interproscan
IPR003929 all species →	Domain	Calcium-activated potassium channel BK, alpha subunit	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10027 all species →	CALCIUM-ACTIVATED POTASSIUM CHANNEL ALPHA CHAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005228 all species →	Molecular Function	intracellular sodium-activated potassium channel activity	Interproscan
GO:0005267 all species →	Molecular Function	potassium channel activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015271 all species →	Molecular Function	outward rectifier potassium channel activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0071805 all species →	Biological Process	potassium ion transmembrane transport	Interproscan
GO:0006813 all species →	Biological Process	potassium ion transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_005881-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005881-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

40.6Max TPM

14.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.74	29.86
polyp at pH7 6	18	18	15.03	24.72
coral polyp · control treatment	16	16	15.26	25.19
coral polyp · oil and dispersant treatment	16	16	10.92	25.83
coral polyp · oil treatment	16	16	13.46	22.67
coral polyp · dispersant treatment	16	16	9.71	19.87
Polyp	10	10	17.88	40.64

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.86
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.08
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.83
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.20
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.42
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.42
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.24
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.63
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.21
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.08
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.77
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.03
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.18
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.01
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.45
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.41
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.02
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.47
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.72
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.55
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.41
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.96
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.04
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.25
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.21
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.09
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.96
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.55
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.88
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.61
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.35
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.20
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.03
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.34
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.31
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.19
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.74
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.51
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.38
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.14
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.20
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.76
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.72
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.37
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.52
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.94
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.11
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.15
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.42
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.83
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.58
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.51
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.07
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.75
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.70
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.63
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.74
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.37
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.31
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.16
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.47
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.31
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.06
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.18
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.67
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.20
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.64
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.79
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.66
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.48
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.07
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.23
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.94
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.01
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.70
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.15
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.97
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.60
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.71
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.57
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.87
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.18
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.40
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.21
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.69
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.03
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.86
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.46
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.09
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.62
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.32
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.99
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.43
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.76
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.90
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	40.64
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	30.30
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	30.30
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	26.88
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	22.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	12.61
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.54
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.05
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.84
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.53

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.