Gene detail

Detailed information of OS493_005993-T1 in Lophelia pertusa

Genomic Location: scaffold_12:3305427...3334839
NR annotation: KAJ7339590.1, Golgi transport complex subunit 7 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_005993-T1

ATGATGCTTTCACTTCTAAAAGAACAAATGAATCTTGTGAAAGAGGACATCAGAGTGGTTGAAGAAAACACAGCACAGTCAATGAAGATGTTAATGGAAATTGACACAGTTAAAACAAGAATGCAAGATGCATCCACAGCTCTGAAGGAAGCAGATAACTGGACAGTGCTGTCATCTGATGTGGATAAAGTTTTTGAATCAGGGGATGTCAAGGCAATAGCAGCAAAGCTTGAAGGAATGCACAGGAGTTTAACTGTCTTACAAGATGTCCCAGATTATGCACAGAGGCGTAGACTCCTGGAAGGTCTGAAGAACAGGCTAGAAGCTCTCCTAAGTCCTAAGATTGTGGCTGCTTTTAATAATCACTCCCTTGATGACACCAGGGAATATGTTAAAATATTTACAAACATTGAAAGGCTGGATCAACTTCAGAATTATTACATCAGATGTCATAAGACAAAACTCCAGAAGACTTGGAATGAAGTTCGTGTTGAGGATCCAAATAAATCAATGCTGGAGTGGTTATCAACATTCTATGATGTCATCCTCTCAACCTGGCACACAGAGGTAACATGGTGTGGTCAAGTTTTTACTGACCCTGGAACTGTACTATGCACTCTAATCAGTCAAACATTGGCTCACTTGGACCCATCACTGTCGTCATGTATCACGGAGTTTATCAAGAATGAGCCAAACATCATAGGAAAATTGATTGAGCTGCGACAGGTAACTTTACGATTTGCTCATGGCTTGGAAAAAGCAGTTTCACAGCAACAAGACAAATGCAGTGCACATGCTGTCAACCTGTTGGTTGATGTATTATATTCACCTTACATTCCATACTTGTTGGATTACCCCGCACTACAACAGACATTCCTTGCAGAGCAGTTACAAGCAACACGGCTGCATGCACATGGCTTTATGGAGACTGCTGGGTTCATGGCTGAATCTGTTGAGAAAATATTTCACCTTGCTGACCAGGCAGTTGAATATTGTGTGGAGCTCACCGATGGTTATGCAGCCCGTGGTCTCTGCCATGTCTTGGAGGAGTTCTTTGGTGCCTATGCAGGACGGATGGATGAATGCATTTCAAGTTTAAGAAAAGAATGTTCCCTTGATGTGGATCCTAAAGTAGACACCACCCAACCACATGAAGAATTCAGTGAGGACTGGACGATGTTTCAGAATGCATTCCGTCTAATTCAGATTTGTGGTGATTTACTTATAAAGATGGAAAACCTGGATAAAACATTACTTGCTGCAATTGTCAGTTCTACAAAGGATTCTGACAGCCAAGAAAGTGATGTCATCAAAGAAAACACCTCTGCTCATTTGAGACCATTTCATTGGTACAATTATCTACAGAAAGAAAGGCCCATCGAGTTTAGTTCATTAAATGAATTAGTCCAGAAGCTTCAAACAGCTGGTGAATCTGCTGCTGTCCTCTCCAGTGTTGCTGAGCAGCTACAGGCCTTGAACGAGCGAGTGCACACGTTAGCTTTTGACATCGTGTTCATCCAAATAAGGCAACAGCTAGCTCAGACACCTAAATTACAGGTTTGGTCCGCTAAGAGTCCCGAGTCTGGGGCAGCATTAAGTGATGAACTTCCTACATTCAGCTTATCTCCGCTAGGATACATTACACATATTGGGGATTACCTTCTGACCCTTCCTCAACAACTTGAGCCATTTATAACGCAAGAAAATCCTGCACTGGAAGCTGCCATGAAAGCAGGAAACCTTCCTTTCCCGGATATACAAGATGAAGATGAGCACCACGCCGGGACCTACTGGCTGGGCTCCATCGCACGTGGTACCATGCACACTTACACAGAGAGTATCCTGAGGATTCACGAGCTCACTCCCTACTCTACTCAACAGCTATTGGCTGATATAGATTACTTCTGCAACGTGTTGGAAGCACTTGAAGTGACACCAAGTCAAACATTGACGCATATTAATGAGTTACTCAAAGCATCTGCTGACAAATTCCATGACGTAGCCACTGATCTTAGTGTGGAGGATCGAATCACCATGGCAATCTCTGGAATAAGAAGCATCCACTAA

Transcript

OS493_005993-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P83436	Conserved oligomeric Golgi complex subunit 7 OS=Homo sapiens OX=9606 GN=COG7 PE=1 SV=1
Q3T1G7	Conserved oligomeric Golgi complex subunit 7 OS=Rattus norvegicus OX=10116 GN=Cog7 PE=2 SV=1
Q3UM29	Conserved oligomeric Golgi complex subunit 7 OS=Mus musculus OX=10090 GN=Cog7 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004820 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10191 all species →	COG7	Golgi complex component 7 (COG7)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019335 all species →	Family	Conserved oligomeric Golgi complex subunit 7	Interproscan
IPR016159 all species →	Homologous_superfamily	Cullin repeat-like-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21443 all species →	CONSERVED OLIGOMERIC GOLGI COMPLEX COMPONENT 7	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0017119 all species →	Cellular Component	Golgi transport complex	Interproscan
GO:0006890 all species →	Biological Process	retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum	Interproscan
GO:0007030 all species →	Biological Process	Golgi organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20294	COG7; conserved oligomeric Golgi complex subunit 7	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_005993-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

24.0Max TPM

11.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.02	20.86
polyp at pH7 6	18	18	11.22	20.00
coral polyp · control treatment	16	16	12.67	18.73
coral polyp · oil and dispersant treatment	16	16	8.91	16.44
coral polyp · oil treatment	16	16	12.89	22.04
coral polyp · dispersant treatment	16	16	9.53	20.10
Polyp	10	10	12.30	23.95

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.86
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.43
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.97
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.18
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.40
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.92
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.19
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.83
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.80
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.20
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.82
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.87
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.63
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.35
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.30
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.73
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.38
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.45
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.09
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.54
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.83
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.26
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.48
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.38
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.65
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.45
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.43
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.28
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.21
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.82
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.62
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.59
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.04
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.50
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.78
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.73
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.85
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.55
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.03
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.65
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.80
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.49
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.38
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.16
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.94
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.41
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.26
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.67
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.44
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.61
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.22
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.93
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.92
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.52
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.01
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.53
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.10
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.92
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.03
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.10
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.02
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.57
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.30
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.67
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.74
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.78
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.70
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.42
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.64
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.23
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.89
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.44
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.10
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.46
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.37
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.35
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.10
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.96
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.25
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.78
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.98
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.56
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.20
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.03
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.31
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.74
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.54
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.42
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.25
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	23.95
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.60
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.57
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.23
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.24
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	10.62
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.11
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.44
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.57
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.68

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.