Gene detail

Detailed information of OS493_006064-T1 in Lophelia pertusa

Genomic Location: scaffold_12:4249051...4259333
NR annotation: KAJ7339657.1, hypothetical protein OS493_006064 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006064-T1

ATGCTGAATGACAGTCAAGGATATTATGAAATTGGACCACAGCGAGAAGACAATAACATCTTTGTTTTGTCCGTCACTATAGGACTAGCTTCCAATTTGGCAAAGTTGATACCATCTACCTTCACCTTGTCCGACCCAAACCTTGGTGGTGGATTTTATTTTTATTACTCGTTACTCAGCAATGACGTGACAAATGAAGCTTTTCAGGATCTTCTCCAACCCAACTTCCCTGCTGAGCGAGCTTCAGTAAGAATCAACAGTAACTTGGAACTTCTCAAAGCATTTTTTGCCCAACATGCAGGACTGGAGGTCCATTTGTGCAGTGGAGACCAATCTTTAGGAAAAAGCAAAAGTCTCTTTTCAAGGCCTTCTCGTCGTCAGTCTTCTGGAGCTGTAGATGACTCTGAGCCAGCTGTTGGAGTATCTGTGTCACTCAAACTCGAACAACAGGATATTGCAGGGAATGTCGCCAGTGCATCATCACCAATTTTAGCTGGACGAGGGATGGGCGGATTCAAACAGGGGATATCTGAAGTGAACAACTTGCCTCATGGAGGCAAGTCTCCTCCAAAACATATCTCAGGCTCCCCTCCAAGAGGAAAACCAAGAGAATCTAACAAAGAGACAGAGATAGCTAGAGAGCACCCAGATAGAACACCACCCCGACCACTATCCAGCACCCCGCACAGCGGACAAGAAAAACCTGGGCCTGCAAGCGGGATTACTGCCGCTGGGACTCGCAAGGACTCTCCTCCCAAGAAGACCAAGATGACAGGCCAGGCTCCTCAGCCTCATATGTCAGTCCCAGGCCCCAGCACTGTTCCTTCACTTGGTACCAGGCTTCCAATTGATCCATCAGCTCACCACTTCTGTTTTTCCATTGACTTGCGCAGCATTGCAAATCTTGATGTCACATCTCCTGTCAACTGCTCCCTAAGGTACACATATCCATTCTTTGGTAGCTCAGCGCCTGTGATGACGAGTCCTCCAGTACAAGTCCAGCGTAACATGGAGGTCCTTCTTCCAAGGTCATTCTGCGCCTTTGATTTTGCCGCTTCTCCGCAGCTACTTCAAGAAACACTCACTAGAGTTCCTGTTATAATTGAGGTGTGGCATAAAGACAGCATGGCTGGAAATGTTTTGATAGGAGTATCAAGTGCTTCACTGGCCACTGTGTTAACTGCAGAAAAAGTTCAAGTCTTGGCACAGGGTAAAGCAGTGACTGGATACAGGCAGATATACAGTGAAAGAATATTAATCCTTGCTACAGAAAAACCTGCCAGGAAGATCGGTGAGCTGCACGTGGTTCTTGGCCTAGAAGACCTGGGTCCAGTTAACATACAGCAGCTGTTGGGAGCCCAAGAATACAGTTTGTCCTCGTCACTTGAGAGTAGCCAGACCTCTAGTGCCATTCCTCTAGCCGAGCCACAGCGTGTTCCGCCCGCTCAACCCGGGCCTCCTCCTGTCACTGACCCACGTGACACAGCAGAGTACAAGACCGCGTTAGAACTGGAACTGTGGAAAGAACAACAGGAAGAAATGTTTCAAGCGGAGATGCAACATCGAGAAAGCTCACACATGAAAGCTCTCGCCGAGGAGTGGAAACGACGCGACAAAGAACGAGAACTAATGGTTAAGAAAAAGCTTGAGGAATATTCTCGATTGGAAGAAAAGCTCAAGCAGTCCATTGCTGATCTGGAGAGGAGAGAGAAGCAGTTGTCTGTAAATGAGACCCAGGTAATGCACATGAAAGATGAATTTGAACGAGAACACGAAAGAAAAATGACAGAGATGAGAGAAGCAGCACGGAGAATGAAAGATGACTGTTCACACCAAGTGGAAATGGAGAGGATGAAAGTGAAGGACTTGGAACAACAGAAACAGAGACTTGTGGAGCAAGTGTACGAAGCCGAGAAACGATATCAAGCAAAGGAAAATGAGTTCATGGCTTACAAGGAACAACAGTTGACAAAACCTGAAGTGAAACTCGAGTCCGAGATAAACCTTTTAAAAATGGAAAAGGTAGAACTCGAACGCAAGTTGGAAACAACAAACAAGTCAAAGATTCACTATAAACAGCAGTGGGGCCGAGCACTGAGGGAACTGGCGCGAATCAAACAACAGGAACAGACCGCTGCCAGAGCGCGGCTCAAAAAGCAAGAGCAGGAACTGGAACATATGCGCCTGCGCTATCTTGCCGCTGAAGAGAAAGAGGTTGTAAAATCGGAAAAAGAGGAGCTGGAGGAAATTAAACTAGAGCTTTCCAGGCTAAAACAACAAGAGGAAGCGAAAGCTCGTCTAAATCCAGCACCAACTGAAGGTCAAGTGAACGCGTCTGCAGCCAGTTCTTCACAAAGAAGAAACGTTCAACATTCGGCTGGTCTTACCTCAGTACACGAAGACGACGATGAAGACATAGATAACAGGATCGCTAAACTGATCGAAGAAAGAGACACTTTACTACATACTGGAGTTTACACCACCGATGATCGTATTATAGTTGAACTGGATAAACAGATTCGAGACGCCATCGCTAGCAAGGGGAGATGA

Transcript

OS493_006064-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0JN62	Centrosomal protein of 120 kDa OS=Bos taurus OX=9913 GN=CEP120 PE=2 SV=2
Q7TSG1	Centrosomal protein of 120 kDa OS=Mus musculus OX=10090 GN=Cep120 PE=1 SV=1
Q8N960	Centrosomal protein of 120 kDa OS=Homo sapiens OX=9606 GN=CEP120 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005633 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12416 all species →	DUF3668	Cep120 protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR039893 all species →	Family	Centrosomal protein of 120kDa-like	Interproscan
IPR022136 all species →	Domain	Domain of unknown function DUF3668	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21574 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0007098 all species →	Biological Process	centrosome cycle	Interproscan
GO:0022027 all species →	Biological Process	interkinetic nuclear migration	Interproscan
GO:1903724 all species →	Biological Process	positive regulation of centriole elongation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16459	CEP120; centrosomal protein CEP120	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006064-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

52.7Max TPM

11.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.09	12.66
polyp at pH7 6	18	18	7.91	12.90
coral polyp · control treatment	16	16	17.25	52.68
coral polyp · oil and dispersant treatment	16	16	13.84	37.90
coral polyp · oil treatment	16	16	15.05	45.46
coral polyp · dispersant treatment	16	16	9.32	25.41
Polyp	10	10	3.54	9.28

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.66
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.16
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.86
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.64
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.97
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.54
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.51
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.80
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.13
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.10
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.93
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.67
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.32
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.09
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.56
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.55
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.15
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.14
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.97
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.08
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.01
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.97
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.75
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.56
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.50
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.50
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.47
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.38
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.20
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.68
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.46
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.70
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.21
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.72
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.72
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.58
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.20
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.81
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.38
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.37
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.43
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.81
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.84
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.80
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.65
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.08
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.71
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.75
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.84
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.07
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.11
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.67
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.43
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.09
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.92
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.68
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.75
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.08
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.35
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.30
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.09
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.52
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.37
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.37
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.85
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.08
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.46
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.45
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.10
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.41
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.22
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.37
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.27
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.06
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.57
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.35
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.24
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.69
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.73
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.20
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.14
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.08
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.26
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.28
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.27
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.89
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.15
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.25
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.12
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.07
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.61
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.53
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.