Gene detail

Detailed information of OS493_006068-T1 in Lophelia pertusa

Genomic Location: scaffold_12:4290792...4320154
NR annotation: KAJ7339661.1, Protein unc-13 B [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006068-T1

ATGGAAGTATTAAAGGAGCAGCTCAGAAAGTACGAGAGAAAGGACATAAAAACCTTAAATGATGAATTAGACAGCGCTTACACAAGTGATGCAGCCCTATACAACCCTTACCTGGACTCAGACCCAGAAGAAATAAATGACCAAGATTCCGACGATGTCGCTGACGGCCAGATCAGCGACAGTGAAGCTGACAGAGACAGAGTAATGATCAATTACACAGACCATTTTGATGCTAGTATTGGACGCACCTCCGATGACATTCGCGAGGAACTAGAAGAAGATGTTGAGGAAGACAGTATGTTACCAAATTTTTCTGTTTTGCCTGAGAGCCAGCAAGGTGAAGAGGAACTTGAAGAGGTTTTCTTAGAAGACTTAGAGTGGAGCATGGAGGTTGAAGAGGGAGCTGAGATCCTGGATGATCATGTAGTGGTCACTGAGCATTTAGAATTTGATCCAGAGACAATGGCGACGTTAAAACAACCAGAGGAAGGCACCGAAAGTGATAGTGACGACGACAACCCAAACAAAACCGGACCCCTGCGACGAAAGGGAGGGTTCAAAGTATCTCCAGGAACCACACGGCGGAAATCGTCATGGAATGAGAAAACAAAAGCACTTCTCAATTCTGCGAATTCTGGATCTCTGATGAGGAAAAGAAGACCGTCAATTCCTTTTCAAACAAAATCAAGCACGAAACAGATTAGAAAACCTCACATGATGATGTCACAAAGAGCGCATTTGAATGATGAGGAGCTGAAACTACATGTTTATAAGAAGTCTCTCCAGGCACTTATTTACCCCATATCAGACACCACACCTCACAGATTTGAGATCTGGTCAACTCAGGTTCCAGCCTATTGCTATGAGTGTGAAGGTCTTCTTTGGGGTTTGGCCAGACAAGGTCTTAAATGCAAAGAGTGTGGAGTCAAGTGCCACGAGAGGTGTAAAGACTTGTTGAATGCTGATTGCTTGCAACGTGCTGCCGAGAAATCAGCTAAACATGGTACAGATGACAAAACCCACTCCATCATCGTTGCTATGAAGGGAAGAATGGAAACCAGAGAAGCAACTAGACCTGAAATATTTGAACAAATCAGTGAAGTGTTTCACATGGAGCCAAAAACACATGCTGGACACATGAAAGCCATCAAAAACTTGATCCTTGATGGAACATCAAAGTGGTTGGCAAAAATATTCATCACAGTTGTGAGTGCGCAAGGACTCATTGCCAAAGATAAAACAGGTACAAGTGATCCTTATGTGTCAGTTCAGATCGGCAGAACAAAGAAAAGGACGAAGACCATTCCACATGAGCTGAATCCAGAATGGAATGAGACGTTTGCATTAATTAAAGTGCGTGTTTGGGATGAGGATGATGATATTAAAGCCAGAGTAAGATCAAAATTGATCAGAGAGCCTGACGACTTCCTTGGACAGACAATCATTGAAGTGCGGACACTCAGTGGAGAGATGGATGTGTGGTATAACCTGGAAAAGAGAACAGATAGATCAGCGGTTTCTGGAGCAATTCGTCTTAGAATCAGTATTGAGATCAAAGGAGAAGAGAAGGTTGTACCGTATCATCAACAGTACACTTGTCTTCATGAGAATATCTTCCATTTCTTGTGCGAGAAGAACAATGGTCAGGTTCCACTTCCAGTGTCTAGCTCAAGAGAAGATCCGTGGAAAGTGTTTTTCCCACATCCAGCTCTTGAAATAGTGAATGAGTTTGCCATGCGATATGGAATTGAAAGTATCTACCAAGCAATGACTCACCTTTCGTGTCTCACAGCTTGCTACATGTGTCCTGGTGTCCCTGCGGTCATCAGCAGTTTGCTTGCAAACATCAATGCTTTCTTTTCTCACACCACAGCAAACTCTGCTACGTCTGCTTCACACAGATTCACCTCCACAAACTTTGGGAGTGAAAAGTTTGTGAAGATTGTGGATCACCTGTACAACACATTAAGAATTGACATTGCAAACTACCGGACAAACTTTCCCTCGTCAAGTGCTGAGAAGCTGGTTGATCTAAAGTCCTCTGTTGATCTGTTAACAAGTGTCACCTTCTTTAGAATGAAGGTCCTCAGTCAGCGACCCACCAGAACAGCGGAAATTGTGCGCGAGTGTGTTAAGAACTGCATGAAAGGAAGCTATGCGTATCTTTATGCAAACTGCGCTGAGCTGTACGACAGAGAGCTAGCTTCAGAAAGTTCCACCTTAGATCCAAATATACAAGCTGGTCCAAAGAGCCTGGATTTCTGGCCAAAACTGATTTCACTGGTTGTGTCTGTGATAGAGGAAGATAAAAGCATCTACACTCAAGTCTTAAATCAGTTTCCAACTGAGCTGAATGTCGGAGAGGTCAGCGCACAAGTGTTTTGGAACATGTTCTGTTCAGACCTGCAGGATATGTTGAAAGACCACAGCTCAAGGCAACAGTCTCGATGGAGTAGTGCAGATTATATGAATCTTCACTTCAAGGTCAAGTGGTTTTACAATGAATTTGTCAGTAACTGTCCTGAACACAAAGGCAAGGTACCAGAATATCCCAGCTGGTTTGAGTCATTTGTTTCACAGTGGCTGACTGAGAATGATGAAGTTTCAATGGAATTTATGATCGGAGCACTTGAAAGAGATAAGAGAGATGGGTTTCCTACCAGTTCTCCACACACTTTGTTCTCAAATTCTGTTGTTGACATTTTCTGCTCACTGAACCAGAGCTTTGAGATTGTCCGGAAACTTGACTGTCCAGATCCAGAAATCCAGACTCGCTACATCATCAAGTTTACCATGGCTGTGCAGAATGTGTTGCTTCAATATGCTGAGAAGCTCATCAAAGAATTCAGTATTTGGTTCAGTCAGGGGAAAACAGAATGTATTTTGATGAACAACATACAGCAACTGAGAGTTCAACTGGAGAAACTTTACGAAACAATGGGTGGAGGAGAAAAGCTTTCCCCAGAGTGTAGTGAAGTGTTTAAAGAACTGCAAGTCAAACTGAATCTCACTCTTGATGAATTGTGTGTGGTATTTGTTCGAAACCTCGATTCCACAATACAAGAAAGTGTAAAAGGTGTTGGAAACCTGCTATTCAAGATAAAAAGTACTGGTAACTTTAACATTGCTTTGCCAAGTAGCAAAAATGTGATCCAAAATGATTCCGAGTCAATTCTACAACCACTGTTGGGAATTCTTGAAGGAAGCTTGGAACTTTTTTACAAAGCTTGTGAGAAGACTGTGCTAAAAAGACTTCTTAAGGAACTGTGGAAGATTGTAATGGTGAACATTGAGAAGATTATTGTTCTACCACCTCTACCTGATATTAAGGAAATGGGAGGAATAACTGGCCAATCTGATTCCAGAAACATGAGTCTAAAGCAGTGCGCTGTGCTGGAAACTGCTCTGGTTAAAATCAAGGACTACTTCCATGCTTCTGGAAATGGACTGAAGAAGACATATTTGGAGAAGTGCTCATACTTACAGTCTCTCAAATCAGCATTGTCCCTGTATACACAGACCACCGACTCACTTATTAAAGAATTTGTTAAGAGTCAGACTTCACAGGAGGATCCAGGAGTTGATGACCCAGTGGGAGAGGTGTCAGTGCAAGTGGACCTGTTCACCCACCCGGGGACAGGAGAACACAAGGTTACAGTCAAAGTTGTTGCTGCCAAAGACTTGAGATGGCAATCACCCGGAATGTTCCGTCCCTTTGTGGAAGTGAATGTTGTTGGCCCCAGCCTGAATGGGAAACGACGTAAATATTCCACCAGGTCAAAGAACAACAACTGGTCTCCAACGTACAATGAAACATTTTACTTTATCCTGAGCAATGAAGATGACCTTGACTCTTACGAGCTTCAGATCTGTGCCAAGGACTACTGCTTTGCTCGTACAGACAACCTTGTAGGTATGACAGTACTGCATTTAAAGAACATCGCAGAGATGGGATCATGCGCCTGTACCCCATCTCTTGGACGGTACATTCAAATGGACTCTAAAGGATGGACCATTCTAAAGATTCTTTCACAAAGGATGAACGATGAAGTTGCCCGTGAGTTTGTCTTCCTCAAAAATAACAACAGATCTGAGGGATTTGACTAG

Transcript

OS493_006068-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z1N9	Protein unc-13 homolog B OS=Mus musculus OX=10090 GN=Unc13b PE=1 SV=2
O14795	Protein unc-13 homolog B OS=Homo sapiens OX=9606 GN=UNC13B PE=1 SV=2
Q62769	Protein unc-13 homolog B OS=Rattus norvegicus OX=10116 GN=Unc13b PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002157 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00168 all species →	C2	C2 domain	Domain	Interproscan
PF06292 all species →	MUN	MUN domain	Repeat	Interproscan
PF00130 all species →	C1_1	Phorbol esters/diacylglycerol binding domain (C1 domain)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014772 all species →	Domain	Mammalian uncoordinated homology 13, domain 2	Interproscan
IPR010439 all species →	Domain	MUN domain	Interproscan
IPR014770 all species →	Domain	Munc13 homology 1	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR002219 all species →	Domain	Protein kinase C-like, phorbol ester/diacylglycerol-binding domain	Interproscan
IPR046349 all species →	Homologous_superfamily	C1-like domain superfamily	Interproscan
IPR027080 all species →	Family	Protein Unc-13	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10480 all species →	PROTEIN UNC-13 HOMOLOG	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005516 all species →	Molecular Function	calmodulin binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007268 all species →	Biological Process	chemical synaptic transmission	Interproscan
GO:0007528 all species →	Biological Process	neuromuscular junction development	Interproscan
GO:0016081 all species →	Biological Process	synaptic vesicle docking	Interproscan
GO:0016082 all species →	Biological Process	synaptic vesicle priming	Interproscan
GO:0016188 all species →	Biological Process	synaptic vesicle maturation	Interproscan
GO:0017075 all species →	Molecular Function	syntaxin-1 binding	Interproscan
GO:0019992 all species →	Molecular Function	diacylglycerol binding	Interproscan
GO:0030672 all species →	Cellular Component	synaptic vesicle membrane	Interproscan
GO:0031594 all species →	Cellular Component	neuromuscular junction	Interproscan
GO:0035249 all species →	Biological Process	synaptic transmission, glutamatergic	Interproscan
GO:0042734 all species →	Cellular Component	presynaptic membrane	Interproscan
GO:0043195 all species →	Cellular Component	terminal bouton	Interproscan
GO:0061789 all species →	Biological Process	dense core granule priming	Interproscan
GO:0098831 all species →	Cellular Component	presynaptic active zone cytoplasmic component	Interproscan
GO:0099525 all species →	Biological Process	presynaptic dense core vesicle exocytosis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15293	UNC13A_B_C, MUNC13; protein unc-13 A/B/C	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006068-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

21.9Max TPM

10.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.10	14.92
polyp at pH7 6	18	18	7.99	13.18
coral polyp · control treatment	16	16	12.39	21.93
coral polyp · oil and dispersant treatment	16	16	14.03	20.97
coral polyp · oil treatment	16	16	10.34	15.26
coral polyp · dispersant treatment	16	16	11.48	18.10
Polyp	10	10	3.73	6.13

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.92
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.73
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.70
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.93
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.28
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.05
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.76
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.61
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.23
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.55
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.28
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.80
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.22
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.18
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.63
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.51
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.29
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.14
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.89
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.73
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.04
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.01
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.69
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.27
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.24
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.13
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.06
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.89
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.01
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.93
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.56
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.54
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.12
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.34
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.98
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.10
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.61
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.13
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.84
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.26
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.33
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.87
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.06
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.78
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.97
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.03
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.51
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.23
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.70
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.02
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.48
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.00
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.79
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.06
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.85
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.36
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.24
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.26
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.56
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.34
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.94
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.63
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.13
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.89
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.82
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.32
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.97
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.03
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.15
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.68
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.10
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.40
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.97
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.60
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.70
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.39
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.18
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.78
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.68
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.65
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.47
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.74
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.13
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.78
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.17
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.51
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.69
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.58

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.