Gene detail

Detailed information of OS493_006186-T1 in Lophelia pertusa

Genomic Location: scaffold_13:817734...833612
NR annotation: KAJ7393218.1, Ubiquitin carboxyl-terminal hydrolase 48 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006186-T1

ATGGCGCGTCGAACAACAAATCGAAAACATCAGGTAACTGTTCTAAAGCAAGCTTGGGAATGGGCGGATTACACGGAGCCTGAAAATATCACTAAAGAAAATGTAGAGAGTGCCTACCTAGTAACTGCGACTGGTTGTTCTCAGGGAACCTGTAGGAGGAACTGTAAAGCTAATCCTAATTGCTTCAATTGCCTTGGAGAAAAATTTTGGCTTGGTGAAATAAAAGAAGATTACTGGTTGGATTGTGAAGATCCAGAAAATGAAAGGAGAACTGAGAATGCTTTTGTTGGTCTTAAGAACCTTGGAGCCACTTGCTATGTGAATACGTTTCTGCAGGTCTGGTTTCATAACCCAGTGTTTCGCTCAGCCATGTACAAATACATCTCTCCTACATGTACAATTCCTGAATATGAATCTAAACATGAGGATAGCAAATCTGCGAATGGCTTGCCAATGACATCAGAGATTGCTAAAATCGCCACAGATTCCCCTGCACTGACCAACCACAAAAGCGAGAATGGCGGAGCCTTGGATAAACCCTCTACTGTTGCCACACCACCGGATAAAGCGTCAGCTGCCCAGCAGGTTCCATTACTTCCTTCTACCACTGTGCTGAGCTCCGAGGAAGCACCGATGACAGTCTGTGGTCACCTCCAGTTGGTTTTTGCTCAGTTGCAATACAGTTTTCGAAGGTACATCGATCCCAGCCCATTTGTTGACAGTTTAGGACTGGACACTGCACAACAGCAGGATGCACAGGAGTTTAGCAAACTTTTTACCTCTTTGCTAGAAGAAACTTTCTCAAAACAGGATGAACCTGAGGTGCAGAACATTGTGCAGTCTCAGTTTGGTGGAGAATACTTCTATGTCACAGAATGTCACAGCTGTGGGAACAAGTCAAAGAGGTTATCTCGGTTTTATGAACTGGATCTGAACATACAAGGACACTCGTCACTTAATCAGTGCATCAAGGAGTTTCTAAAGGAAGAAAAGTTAGATGGTGATAATCAGTACTATTGCACTCAGTGTAACAGCAAACAGAATGCCGCTCGCTACATTGAACTGCATTCCCTGCCGCCAGTCCTCAACCTGCAACTGTTACGATTTGTGTTTGACAGGAAAACAGGGTACAAGAAGAAACTGAATTCCTTCATTCAGTTTCCAGACATTCTTGATATGAAGGACCATGTGAAAAATGGATGCATTGGATCTGAGTCAGTTTACGAGTTGAGTGCAGTGTTGATCCACTTTGGAGTGAGTGCTTATTCAGGACACTATGTGGCTCACATCAGGGATAAAAAGTCTGGCTCATGGTACAAGTTTAATGATGAAGATATCGTCAAGATGCAAGGAAAGTTAAAACTATCTCAGGATGAAGATACAGCAGACACTAGCAGCAAGCCGACCAAAAGACCCAAATGTGCAAAAGGCTATCACGTATCCAAGAATGCTTACACATTGGTGTATACCCTCCAAGGACATAAGGGTGTTGGGAGTGAAGATGACGATGTCGAAGTTCCTCCTCATGTACTAGAGTTGGTGGCGACAGACAATAGTCGGTTTGAACACTGGGTTACACAGGTCAAAGCATTTAGGGAAAAGTTGATCGGCAAAGGGAAGGCAAGGCAAGCTGAAATAAAGAAACTTTATCTAGAAATGCCAGTTACTTCAGAAACAGAATATGAATGGATTTCTACAAAATGGCTGAAAGATTGGATGAACGAAAAGACTGACACGCCACCAGTGGACAATTCCTCTCTGCTGTGTTCTCATGGAAAACTCAATCCAAGTCAAGTTGTCAATGCTAAGAGAATCAACATCAAAACTGCTGATGAAATATTCAGAAAATACGGTGGACTGCCAAGACTTCAAAGTGACTCTATGTGTATCAACTGTGTTAAAGAACAGTGCAGAAGAATACGATTTGAAAGCCGACTGGCTGAAGATTACAAGTTTGTGTCAGATACTCTGAAGCAGTCTCAAACATCAAACAGTGAAAAGTTATTTTGGGTCGGTCGACGGTCGCTTCTTAGATGGAAAGCCTTGGCAAACTACCACGAAGAGATGCGACAGAGTTTGATGGACAGCTGTCAAGTTACAGCCAATCACGACACAGAGGACGAAGACGACGCCAATGCCAGGGGAATTGAAAATAATGATGCTAGCATGAAGGAACAGGAGAACGCGCCACAACAGCTGGACAAGAATCTGCAGGAGGCTGCTGAGGAAGACGAGGATGACAGTGATTCAAAGTTCAACGAAGACTTACTTTGCGAGCATGGAGAACTGTCCTCGGAAGAATCATGTCGGCGGCTTGTACCAGATGTCGTGTGGCAGAGGCTCAAGTATTATTTTCCTGCCGCACCCGAGTGTCCAGCTCCTCATCCAGTGTGCAGATCATGTCAGGCGGAAGACGAAGAAGAACGACAGAAGAGCGAGGTTTACAAATTACTAGCATCAGAGCAGAGAGCTGCCGTTAGTCATCTCTATCTCGACAGGAATCGACCGTCCTTTGATAACAACGACCCGTTTGTTGCCTGTGCCATTTCAAAAGATTTTGTCGATCATTGGAGGCAGTTCTTAAGGTACCCCGTAAGGAATGTCCCACCGAAGACCATCATTAATGCACCTCTGCTGTGTCCCCATGAAAAGTTCCTCTTCAATCCCGAGTGCGATGAGGACATGGATGGTGCGAGCCAACACGTCACAAAAAATGTAACAGAAGACGATGCGAGGGAACTGGTGACTAGCCCTGAAGTGTGCACAGAATGCTGCCATGCGCGGATACAAGAACGAGCTCAGCACGTGGAAAATTACCGCTTTGGTACTATCTACGTGCGGAAAATCACAAAGGACCACAGCGAGAAGGACATACAACAAGCCATGAATGATAGTACCTCGAGCAAAGAAGGAGATTATTTCGACCCAGACTTCCAGACTCCGCCGGACAGCACCGTAAACAGCGCGGAGAATCTCGCTGACTGTTGGATCAACCGAGACTTTAAGAGATGTGAAACTACAGCTGATGAAGAGTTTTTCGGTGATGCCGATGGATCAGCATCTCACTTTGAATGGCGTCACACTCTCCAACAATGA

Transcript

OS493_006186-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q86UV5	Ubiquitin carboxyl-terminal hydrolase 48 OS=Homo sapiens OX=9606 GN=USP48 PE=1 SV=1
A0A0R4IB93	Ubiquitin carboxyl-terminal hydrolase 48 OS=Danio rerio OX=7955 GN=usp48 PE=3 SV=1
Q5ZM45	Ubiquitin carboxyl-terminal hydrolase 48 OS=Gallus gallus OX=9031 GN=USP48 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003580 (this species only)
Ubiquitin family	DUB\|USP\|USP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00443 all species →	UCH	Ubiquitin carboxyl-terminal hydrolase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR050164 all species →	Family	Ubiquitin carboxyl-terminal hydrolases	Interproscan
IPR001394 all species →	Domain	Peptidase C19, ubiquitin carboxyl-terminal hydrolase	Interproscan
IPR018200 all species →	Conserved_site	Ubiquitin specific protease, conserved site	Interproscan
IPR035927 all species →	Homologous_superfamily	DUSP-like superfamily	Interproscan
IPR033841 all species →	Domain	Ubiquitin-specific peptidase 48	Interproscan
IPR028889 all species →	Domain	Ubiquitin specific protease domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24006 all species →	UBIQUITIN CARBOXYL-TERMINAL HYDROLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0016579 all species →	Biological Process	protein deubiquitination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_006186-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006186-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

12.5Max TPM

6.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.97	10.61
polyp at pH7 6	18	18	7.81	11.37
coral polyp · control treatment	16	16	6.06	11.17
coral polyp · oil and dispersant treatment	16	16	4.58	12.46
coral polyp · oil treatment	16	16	6.54	10.28
coral polyp · dispersant treatment	16	16	4.08	9.22
Polyp	10	10	6.93	11.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.61
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.54
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.88
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.22
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.07
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.64
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.46
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.59
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.45
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.95
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.87
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.83
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.83
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.75
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.37
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.78
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.23
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.71
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.68
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.35
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.17
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.02
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.89
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.76
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.30
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.75
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.56
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.45
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.60
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.65
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.42
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.62
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.59
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.10
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.03
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.55
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.28
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.98
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.96
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.93
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.91
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.51
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.97
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.46
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.51
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.43
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.33
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.17
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.12
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.79
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.42
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.12
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.07
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.06
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.44
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.90
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.28
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.44
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.29
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.28
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.22
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.86
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.70
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.68
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.65
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.24
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.08
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.95
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.83
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.31
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.04
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.22
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.31
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.90
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.36
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.25
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.67
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.25
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.21
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.88
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.32
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.22
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.17
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.35
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.87
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.02
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.77
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.56
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.05
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.58

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.