Gene detail

Detailed information of OS493_006215-T1 in Lophelia pertusa

Genomic Location: scaffold_13:1139827...1150358
NR annotation: KAJ7393246.1, Dynamin- GTPase protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006215-T1

ATGGTCATTCAACTTCGTGTTCGGATTGACTGTGAAGCCATTGCAGAACCCGGTCCGCGCGTTGAAGCTTCGGAGATGCTTGTAGAAGAAGGAGGACCCCTAGCAGTTAATCAGGGAACGGCAGTAATACCTATTGCATCAGGTAAACCACAAGCAGAGGCGACAGGAGGCCTTGGGGTAGTAGATACCAGCAATGATGGCCTTCCCAGCGCACAAAGAGTTTTAAACTTCATTGCGTTAAAGAGCTTCCGAACTGTTGATCCATCTAAACCAGAGGAGTTAAATGGCTTTCTACAGTATATGGAAAAGATACGAAAAGTGTTGATTCTGGATGTTCAGCCAGGAAGTTTAATAATAACAGTGGAATGTAGTTCTCTGGAGATACTTGAAGGATTGTGGGACGCGTACTGTGCAGGTCATCTCAATGAAATGGCACAACTATTCCTTGTCACAGACAACATTCTGAAGGAGTTTGGTCTTATTGAGGTGAAACTCACAACAACCATTTTGGAGGAGGAATATAGAGCTTGTCGAGAGTATTTCTTGCAGAGTCCAGCCAAAAACCTAGAACCCCTTGGTCAATCCGCAGAGATGGCCTTCAAAACGTATACAGAGAAAGACAGAAGTCTGTTCAAAAAATTGCAAGAGAACAGAACAGAACAAGAGGAGCTGCAACAGCGTTTGAATGCTCTTAAGGAACATGAACGACAGATGGAGGAAGAAAGTGAAACTCAAGAAAAAGCTGACATAAATATGTCAGGCGTGGTTAAAACACCCGTTGCCAAATATGGGCGGATTAGCGAGTTTGGAGTGGTGTTGGATTTCATCCAAACCATGATAAGCAACGACACTCTTCGACAGGCCTTCAACATTCCACATCTAGTCGTGGTCGGTCGACAAAACATGGCCAAGACCACGCTGATAAACCGACTGATCGGTCGATATCTTCTCCCAATGCGACGCAATGAAACGGCCAACACCCTTCAGGCACGCACCACGTATCCCATAATACTCAATCTACGTAAAGGAGAGAAGAGGACTGTGGAAGTGAAATGTGATAAAGTACCAGGAATTGGGGGAACTGTGGAAAACCCCACGGATGATGTGGTGGAGAATTTTCTCAACCAGGTTTCAGGGCATCTTCCCAAGGAAGAGGGAACTCCGATCTCAAAAACCCCTGTTAATGTTACACTGACAGGCCCCGAACTCACGAACCTCACCTTGGTCGACCTTCCCGGCGCCCATTTCGCCAACGACGACCCGCGAATGAACCACGTGACCCAAAGTTTAGTGCTAGAGTACATCGAGAAGAACACAAATAGCATTATCGTGATAGTGTCCGAGGTGGGGGACCCCACAGGTGACAGTGCAATAAACCTTGTCATGCAAAAGGCCGCTGATTTTAGGAGCCGTACCATCTGTGCACTAACCAAGCCAGACAAGCTGAGAGACTCTGATGACATGGGGAAAAGGGTGGCCATGAATGAGTCCAGCTTTACACCGGAGGATAACCGCTTTATTTTGCTTCGAGGCAAAGACGGCACAGACCCGAACGAGAAGGACTGGGACGCTGAAATGACCCGTATAAAGGAGAAGGAATGGTTCGGGCGGCACAAGCAGTACAAGGACATCCAACATGTGTGTGGTATTGATCGACTAATGGACACCATGATCTCTTTACTGGCCGAGAAAATGATCACTGAGATTCCCATTCTGGTGCGACAAATGAAACAACGAAAAACAGTGGTGGACGAAATGCTCAAAAAACTTGAGGACAGTGAAGTGCCTGAGTCGAGTGAGGGAAAGGGCGCAGTCGCTATGAAGCTGAAGAATAACCTCATCAAAGACTGTTTTCAAGGTGGACCCTTTGGCCTGCGTGATGATGATGAGATCAGAAAACAGCAAAAGAAGTTGGAGGGTGTGGCCGCCCCGCTTGGAGAAAGCAGTGAAAACAGCCAGCTGCTGCAGAAACTGCTGTACGAGGATTACACAGGATATCAACGCAATGGCAAAGCAGTCAGAGTAGTTAGAGTCCAGAGTCCAGTTGATCAATTGTTTCCATTGTCGCAGAGTCTTGTTCAGAATGTCGAGGTAACTCTACGAAAAATCGTGCAAAAATCCATCGAGCACAGCCTGTCCAAGTTCCCCAGCCTCAAACAAGCGGTTGAAGCCAAAGTGGTGAGCAAAATTTTTGACACAAAACGCGACCAGACGATCCAGTTCATCCAACAGTTTCTTGCGATGCAGAAGAAAAACATCGACGTGGTATACGCACCAGTCCCCATGCCAGGCGAGATAAGCCTCTGGAAGGCTACACTATGA

Transcript

OS493_006215-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O00429	Dynamin-1-like protein OS=Homo sapiens OX=9606 GN=DNM1L PE=1 SV=2
Q8K1M6	Dynamin-1-like protein OS=Mus musculus OX=10090 GN=Dnm1l PE=1 SV=3
Q7SXN5	Dynamin-1-like protein OS=Danio rerio OX=7955 GN=dnm1l PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002531 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20694 all species →	TRADD-like_N	TRADD-like N-terminal domain	Domain	Interproscan
PF01031 all species →	Dynamin_M	Dynamin central region	Family	Interproscan
PF00350 all species →	Dynamin_N	Dynamin family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR049341 all species →	Domain	TRADD-like N-terminal domain	Interproscan
IPR000375 all species →	Domain	Dynamin stalk domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR022812 all species →	Family	Dynamin	Interproscan
IPR001401 all species →	Domain	Dynamin, GTPase domain	Interproscan
IPR045063 all species →	Domain	Dynamin, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11566 all species →	DYNAMIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003924 all species →	Molecular Function	GTPase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005874 all species →	Cellular Component	microtubule	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005525 all species →	Molecular Function	GTP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_006215-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006215-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

20.4Max TPM

6.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.44	17.47
polyp at pH7 6	18	18	7.51	20.45
coral polyp · control treatment	16	16	4.98	13.44
coral polyp · oil and dispersant treatment	16	15	4.46	10.58
coral polyp · oil treatment	16	16	3.95	9.32
coral polyp · dispersant treatment	16	16	6.97	16.92
Polyp	10	10	6.68	19.41

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.47
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.28
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.03
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.73
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.64
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.20
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.84
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.08
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.82
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.63
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.10
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.20
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.94
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.62
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.96
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.89
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.99
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.13
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.24
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.53
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.35
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.26
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.08
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.01
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.67
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.66
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.40
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.05
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.78
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.08
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.05
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.47
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.03
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.15
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.43
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.83
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.72
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.43
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.21
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.70
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.43
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.09
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.33
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.58
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.16
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.11
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.64
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.91
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.72
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.80
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.73
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.49
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.84
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.25
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.05
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.32
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.35
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.56
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.07
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.62
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.27
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.93
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.16
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.41
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.03
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.77
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.65
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.24
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.73
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.45
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.05
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.13
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.02
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.76
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.38
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.75
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.30
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.46
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.39
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.86
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.66
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.97
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.13
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	19.41
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.50
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.12
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.87
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.53
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.60
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.20
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.33
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.88

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.