Gene detail

Detailed information of OS493_006480-T1 in Lophelia pertusa

Genomic Location: scaffold_13:3746218...3755562
NR annotation: KAJ7393497.1, GRB10 interacting GYF protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006480-T1

ATGCAAGCTAGCATGCAAGGAGCACACTCACGGAAGGAAAGCGACGACTTCTCCAAGCTTTTCCATGGAGACGATAGAGAGAACTTAGATCTTGGTGGTGATAACTTTATGGTGGACCCAGCTTTAGTAGAGCCATCGTTATCGTTTCACCAGCCGAAGTCTAGTTTCACTTCGTTTCGTGTATTTATCAGTTGGAGTAGCACAGGAATTCAAGCTGTCCATTCAGTGCTATCTACCTTATGCAGTGCTCTTGTGAAACTTTATGTTCACCCTGGCGGATCTGTACTGGTTTTACTAGCTGCCATAATCATTCCTGTAGTTCTGGGCTGGAGTGTGTTTCATCGGGATTACAAAGAGAGGGGTGAATACTTGGTTATAGACAAATCTTTAGAATCGTTTGAAATTCCGGGGCACATCAGTGCTCAACGGGAAGACATGGTTTACGTCGCATCAAAGCACTCCAAAGAACAAAAGGGGTTTCTAACTGGGAGACGACGGAAACGCTCGGCAGAGTCACCAACGACAAAACCAGCTCACGTTTATCAAAACAAAGCTGCCTGGACCTTGGAGCTTGTTTACCTGGCGATCGGGGAAGACGACCTGAATATCTTCACGAAAGAACGACTCGAAACTATTCATCACATCGAGCGCAGCCTTATGAATCAAGAAGGCTTCACGGATTTTTGCTGGAAGTGGTCTGAAGTGAAGCGCGATCCGTTCCTTACAGCTGGCTGTACACCTCCGATCTCTCTAATTGACTTTTTCTACCCGTCTATTACTCCACAGTGGCGAATATATGATGGGCAAGGCATGGGTTATGGCGCGAATGGACGGAACCTCACGGAAGCTAGCATCAAACAAAGTCTTGACTTACTTCTCACGAAACCCTTTACCTACTGGTTCGTCGATGGCTCGTTTTCGGTTGACAATCAGAAAAGCAGGTTCTTGCGTGCTGAAATAAAGTTTGGCTACCCGTTAAAGTCTGGGGGGAGCTATCATGCTCAAGGCGAAACTTTCCAAAAATATTTGGTGAAATACGTCGAAGGCTTGAGGGAATTGTCAACAGACAAAGTACGATTGTTGTATGGTGGAACCACCATCTTTGACTACGAGGTGAATAAAACCTTGTGGGCAGACATCAGACTGACGTTCTACACCATCGCGTTTGTCGGAGCATTTGTGTTGATCTTCACAAGATTCTCCATTTTCCTCACTGTAGCTGGTATCATCAGTATTTCAACACCCCTCTGCTTAGCTTACTTTCTATTCCGCATGGTATTCCATGTCAAGAGTCTTGGGATTCTTAGCGGCATTTCGTTATTTATTATCATTGGTATAGGAGTGGATGACGTGTTTGTCTTCATTAACACTTTCCGTCAAGCACACAGTGCCAGAAGTTTGGAAGCTCGCATGACGCATACTCTATGCACCGCCGGGAAAGCTACCTTCTTCACATCCTTTACTACATCTGCGGCATTTGCTGCTAATTGCCTTTCTCAGATGCCTGCAATTCATGATTTTGGTTTGTTCATGGCGCTGATTGTAAGCAGTTGTTGGTTGACTGTGTTCTGCACCATCCCCCCGGCTCTTAATCTGTGGCATCGTTACATTGCAAAGATTGAAGCAAGGATATTTCAGCTGATATGTGGGCCGATAAGTTGCATCTTTGCCAGTAGAAGTTCTGGTCTACCTGATGACATTGTTCAGTTTCTATCGGGGAATGATGGAAGCCACGCCCAACTTCAGTCCTCGTCTTCCTCATCAGAGGTTATTGAACTTTCGATTAGAACGCCAGTTCAAGATGACGATTCACAGCTTGTTCAACTGGACAGCAGTCCTCCTAACTCACATAGCCCGTCGCCGAGTTCCAGTGATACTGACTTGGCTATGTACGATGACCCGAACAGCACATTTGATTTGCAAGCAATGCCGTTGATGCGCAACAGAGCTTCACAACCAAGACCTGCAGTTTCTCAGCAAGGCCAGCACAACAGGGGACGACATTGTCGATGTGGGCTGCAGGCCTTTTTGTATCACTGGTTAGCTGTTCCAATACAGAAGTATCGTTATGCTATCTTGGGGGGTTTTATCATCATTCTTGGGACAACCATAGGTTTGGACGTGCAAATCCGACCATCTACTAAACCACCTGCGTTCTTCAAAGAGACCACTAACTTACAACAGCTGCTGGACCTGAAATACAACATGAGCAGCGACAAATTGAACTTGAACGATATGGCATGGGAACTGGTTGGAAGTGACATTCAGGCAAATGGCATTGACACCCCAACTCCTACAAAAAAATCCAAAGAGAACAATGGCCTCAAAACACCAGCGTCTACACCTACTCAGTCTCCTGCTACTGCAGAACAACCAGGGCCACACCAAAAGACAAACATACTGCAGCCAAAAACGTCTGAATCAAAAGTTACTCCTGCTACAAAGACAACTACCCAACAGAAAAAGAAGACGTCTACGCCAACGCCAAGTTCCAAAAAGACATCTACCTTAGAATATCTGACCAAGAGCACAAAGAAACCAACAAAACAAAGTCATGTAACTCAAAACCCAAACCAATCAAAGACCCAAAAGACAGCAGTACCTGCATCACAAACATCCAAACCAGCATCAAGTGATTCTGGGAATGTCATTGATTTATCTACAAATTTGCCAAATGCGACTTCGCTGCCACCTCTATGTCCTGGGGGCTGCCGTGCTATCCCAAAACCCATTGTGGATTCATCGGCAACTGTTTATGTGGTGTTTGGTTTGAAGAAGATTGATCGTAGCAAGATAACCCGAGAGCATGTCATTGAGAAAAAGGGCGATGTTATTCCAGACTATGAATTCACAGATCTGTTCTCAAACGGGCACACTAATTTCCTCAAGTACTCTTGCAAACTGTGCAAAGCACTGAGCGGCAACAAGGAGCTGGTTCAAGAAGGCGGCGCAGATTGTTTCCCTGCCTGGATAATGGATACAATCAGCTCTAATATACAGCACTATGGTCGTAAATCACGAATCTATGAAGACTGTCATGATATAAGAACGCCATCGTTCAGCACCGGGAAATCACGTGCAAAGGTGATGAAGATGCCATCAAAAGACCTGAGCCATGGAAATTTTACCTACTGGATGTTAATGGCATTTGAATCGACTATTTTCATGGCAAGTCATCCAAGGAAAAAGTGGCGGATTTTGACAAATGGAACAGTTTTTTGA

Transcript

OS493_006480-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A3KFU9	Protein dispatched homolog 3 OS=Mus musculus OX=10090 GN=Disp3 PE=2 SV=1
Q9P2K9	Protein dispatched homolog 3 OS=Homo sapiens OX=9606 GN=DISP3 PE=1 SV=2
B9U3F2	Protein dispatched homolog 3 OS=Gallus gallus OX=9031 GN=DISP3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007833 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02460 all species →	Patched	Patched family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042480 all species →	Family	Protein dispatched homolog 3	Interproscan
IPR003392 all species →	Family	Protein patched/dispatched	Interproscan
IPR000731 all species →	Domain	Sterol-sensing domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46687 all species →	PROTEIN DISPATCHED HOMOLOG 3	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24683	DISP3, PTCHD2; protein dispatched 3	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006480-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

117.8Max TPM

27.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.27	23.28
polyp at pH7 6	18	18	15.32	26.61
coral polyp · control treatment	16	16	32.21	68.37
coral polyp · oil and dispersant treatment	16	16	51.99	111.52
coral polyp · oil treatment	16	16	23.19	41.35
coral polyp · dispersant treatment	16	16	44.43	117.84
Polyp	10	10	6.21	12.24

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.28
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.73
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.36
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.88
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.21
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.45
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.67
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.29
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.88
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.98
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.17
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.05
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.68
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.64
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.65
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.33
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.78
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.74
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.61
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.25
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.25
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.76
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.66
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.93
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.21
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.61
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.42
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.10
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.08
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.68
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.21
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.29
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.12
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.71
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.55
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.37
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.99
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.32
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.76
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.09
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.39
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.71
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.61
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.27
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.63
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.55
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.24
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.51
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	111.52
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.15
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.77
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.73
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.72
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.03
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.40
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.26
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.44
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.31
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.89
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.19
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.45
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.17
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.35
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.41
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.11
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.80
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.72
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.15
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.41
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.13
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.83
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.85
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.07
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.58
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.88
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.19
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	117.84
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	75.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	71.91
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.81
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.11
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.74
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.18
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.02
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.47
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.32
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.82
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.59
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.85
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.46
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.60
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.24
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.79
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.27
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.65
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.17
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.53
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.39
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.69
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.06

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.