Gene detail

Detailed information of OS493_006589-T1 in Lophelia pertusa

Genomic Location: scaffold_13:4456412...4473627
NR annotation: KAJ7393603.1, Procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006589-T1

ATGAACAGAGGAATACTTCGGTGTGTTGGCTGTACTCTTTTAGCCGTCTTGGCTGTACTTTTAACTGATGTTTGTAGTGCAGAACAAGGATTGGATGAGCTGAAATTGCTTGCTATAACGGTAGCAACAGACGAAACAGATGGCTATAAAAGATTTATGAGATCTGCTAAAGTTAATAACATCGATGTGAAGGTACTTGGGATGGGCGAGGAATGGCGCGGTGGAGATATGAGGAATCCTGGTGGAGGACACAAAATAAACATTCTTAAAAAGGAAACAGAACTTCACAGGAATGAAAGCAATCTTGTGCTTATGTTTGTGGACAGCTATGACCTGATATTACTAGCAGATCCTCAGGAATTCCTGAAAAAGTTTCTTGAGTTTAATGCCAACATGGTCTTTTCTGCCGAAGGGTTCTGCTGGCCAGACAGGGGGCTCAAAGACCAATACCCGGAGGTTTCTCATGGAAAGAAATATCTTTGTTCAGGAGGTTTTATCGGTTATGCATTAACATTCCACCAGGTCGTGGCTGATCATGCCATTGAAGATGTGGAAGATGATCAGCTGTATTACACCAAGATATTTTTAGACAAGCAGAAAAGGGATAAGCTCAAATTGAAGTTAGATAACAAAGCAGAGATCTTCATGAACTTAAATGGAGCACAAGATGAAGTAGAAATCAAGTTCAGCGGTGACAAGGCGTGGCTGGTGAACAAGGAATACAACACTCAACCTCTTGTTGCTCATGGTAACGGCCCTAGTAAGCTGTTTTTAAACTACCTGGATAACTATCTGCCAGATAAATGGAATTTTAAAGATGGCTGTACTGCTTGTTCAGAGGATACATTGTCTTTAGAGAATCTCAAGAAAGAGGAATATCCTAAAATCCTGATGGGACTCTTTATTGAGAAGCCAACACCTTTCATACCAGAGTTTTTGACAAGAATGATGCAGTTAGATTATCCTAAGAAACGTATTGATATTTTGGTTCATAACACGATTCCATACCACAAGCCACAAATTGGAGACTGGTTAACAGATGAGATCAAGGATCAGTTCAACTCTGTTACTGTACTGCAACCTGAAGACAACGTGAATGAATATCAGGCCAGAAATCATGCTGTTGAGATGTGTAAAGAGAAGAGCTGTGACTACCTTTTCTCTGTTGATGGTTCTGTTGTTTTGACCAACAAGGACACGCTGAAGATTCTCATCAAACAAAACAGACCTGTGTTAACGCCTGTTATATCAAAGCATGGCAAACTGTGGTCAAACTTCTGGGGTGCACTGGGAGACGATGGATATTATCTTCGCTCACGTGATTATCTTGCAATTGTTCAGAAGCAGAGAAAGGGAGTATGGAATTCTCCTTTCATCACAAACATTTATTTGATCCAAAAAGAAGTCTTGAAACAGATGCAAGGAAGCTTTGGTCCTTCTACGCTTGATCCAGACATGGCTATGTGCAAATATTTCAGAGATCATGGAATTTTCATGTATGCAACCAATCTTCATGAATTTGGCCGTCTGCTGGAGACGGAGAATTACAACACAAATCATCTGCACAATGATTGTGGGAGATCTTTGATAACAGAGTGCCCAAGTTCAAATGACTGGGATGAGAAATACATTCATGAAAACTATTCTCAAAACATGAACCTCAGCATTCCTCTTGCAGAGCCGTGTCCTGATGTCTACTGGTTTCCTATCGTGACGGACACTTTTGCTATGCATCTTGTTGAGGAAATGGAAAATTTAGGTGACTGGTCTGGAGGAAGACACGAGGATAAGCGACTGTCAGGAGGCTACGAGAACGTACCTACTGACGACATACACATGAACCAGGTTGGTTACGAAAGACATTGGCTTCACTTTCTCAAAGAGTACATTGTACCTGTGAACACCAGATTATACCCTGGCTACCACTCTGAGGCTCGTTCTATCATGAACTTTGTTGTGAAGTACGATCCAAACCGACAGTATTATCTCAGACCTCACCATGACTCGTCCACGTACACCATCAACATCGCTTTGACCGACCAGGCATCGATCATGGAGGCGGGGGCTGCAGGTTTTTGCGGTATAACTGCCAAGTGA

Transcript

OS493_006589-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9R0E1	Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 OS=Mus musculus OX=10090 GN=Plod3 PE=1 SV=1
Q5U367	Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 OS=Rattus norvegicus OX=10116 GN=Plod3 PE=1 SV=1
O60568	Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 OS=Homo sapiens OX=9606 GN=PLOD3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004076 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_006589-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR029044 all species →	Homologous_superfamily	Nucleotide-diphospho-sugar transferases	Interproscan
IPR050757 all species →	Family	Collagen-modifying Glycosyltransferase 25	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10730 all species →	PROCOLLAGEN-LYSINE,2-OXOGLUTARATE 5-DIOXYGENASE/GLYCOSYLTRANSFERASE 25 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005783 all species →	Cellular Component	endoplasmic reticulum	Interproscan
GO:0008475 all species →	Molecular Function	procollagen-lysine 5-dioxygenase activity	Interproscan
GO:0017185 all species →	Biological Process	peptidyl-lysine hydroxylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13646	PLOD3; lysyl hydroxylase/galactosyltransferase/glucosyltransferase	EC:1.14.11.4 EC:2.4.1.50 EC:2.4.1.66	Glycosyltransferases	ko01003	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006589-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

82.5Max TPM

41.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	39.86	56.95
polyp at pH7 6	18	18	43.09	63.65
coral polyp · control treatment	16	16	48.35	67.63
coral polyp · oil and dispersant treatment	16	16	39.79	59.95
coral polyp · oil treatment	16	16	44.70	66.05
coral polyp · dispersant treatment	16	16	44.48	82.54
Polyp	10	10	24.39	37.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.95
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.90
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.10
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.71
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.27
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.27
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.39
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.31
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.73
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.83
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.37
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.32
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.59
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.14
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.02
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	63.65
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.99
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.62
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.47
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.06
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.98
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.25
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.50
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.14
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.90
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.07
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.96
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.29
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.70
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.69
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.15
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.68
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.54
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.63
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.18
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.39
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.38
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.08
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.01
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.76
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.37
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.95
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.06
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.05
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.21
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.86
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.30
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.95
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.52
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.51
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.43
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.66
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.32
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.83
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.53
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.40
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.86
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.98
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.23
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.89
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.53
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.39
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.60
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.08
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.19
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.69
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.82
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.91
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.58
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.01
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.72
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.61
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.02
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.80
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.64
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.20
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.76
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	82.54
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.58
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.33
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.45
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.08
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.44
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.37
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.85
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.19
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.50
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.25
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.32
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.84
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.17
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	37.85
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	35.82
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	34.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	27.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	26.87
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	22.03
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.33
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.28
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.32
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.58

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.