Gene detail

Detailed information of OS493_006595-T1 in Lophelia pertusa

Genomic Location: scaffold_13:4497616...4511231
NR annotation: KAJ7393609.1, Chloride channel protein 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006595-T1

ATGATGGAAGAAGAGGATTCCTATGGGTTTGAGCAGACTCTGATGTATGGTCGTTTTACGACCACACAACTTCAGAAGTATGCTAAAGAACAGGGTGCGCGTTTACGACGAGAACAGCAACAGAGGAGAGAGGAACAAGAACAAGATGATGACTTTAGAACATACGATCACTCATGGCTTGGTCCAGTAAAAAGGTTTGTAGAGCGGTTGCGACCTTGCTGGAGTCGTCTGGGAAGTGATTGGGTGTTCCTGTTGATTCTTGGAATAATTATGGCACTCATAAGTTTTGTGTTGGACCTGGCTATTGATAAATGTCAAACAGCGCACATTTGGTTGTACAGTTTACCAAGCAACATGTTCCTGCAGTACATTGTGTGGACCTCATTTCCTTTGGTCCTTATAACGTTTTCCGTTGGATTCACGTATCTTGTGTCTCCTCATGCTATAGGTTCAGGAATTCCAGAGATGAAGGTCATTTTAAGAGGCACAGTGTTAAAACGTTACCTGTCGCTACGAACACTGATTGCAAAAGTGGTTGGTCTTCTTACAGCTCTGGGAAGCGGTATTCCCATCGGAAAAGAGGGTCCTTTTGTGCACATTGCAAGCATGGTTGCTCGATCCATGGGAAAGTTTTTGGCATCATTTAAAGGAATATATACAAACGAGTCCAGAAATACAGAGATATTAGCGGCAGCATGTGCTGTGGGTGTATCAAGCTGTTTTGGATCACCTATTGGAGGGGTACTGTTCAGTATTGAGGTAACTGCTACTTATTTTGCTGTGCGTAATTACTGGCGTGGGTTCTTTGCTGCGGTCTGTGGAGCACTGATGTTTCGTCTGCTGGCCGTGTTTGATAAAGAAGAAGAAACTGTTACCGCTCTGTTCAAGACAAATTTTAGACTGGACTTTCCATTTGATGTGGAAGAGTTTATCGCATTTGCATTAATAGGGTTGTTTTGCGGCTTTGGAGGAGCCCTGTTTGTATTTACACACAGAAAGCTTGTTGATATTCAGAGAACTCACAAACATACCATGGTGGCAAAGTTTCTTTCAAGAAATCGTTTTGTGTACCCAGCAGTTATCATTTTTATCATTGCTACAATAACATTTCCCAAAGGACTTGGACAGTTCATGGCTGGAGAGTTGACATCAAAGCAAGCGATAGATGAGCTGTTTATTAACATCACATGGTCTGAAGCACGAGAGTCAGAGGATCAAGCTAGTTTGAATGTTCTAAAGCACTGGGATGGAGCTAACACCAACATTTATGTCACTTTGGTTATATTTATTGTCCTCAAGTTTATCATGACGGCAGTATCTGTAGCACTGCCCATTCCTGCTGGTGTCTTCTTTCCTGTCTTTTTAATAGGTGCGGCATTTGGTCGGCTTGTGGGTGAAGCCATGGCAACATGGTTTCCTGATGGTGTGAACTCTGGAGATGCGATAACACCCATTGTACCAGGGGGGTATGCTGTTGTTGGAGCGGCAGCCATGTCAGCAGCAGTCACACACACTATCTCTACATCTGTGATTGTGTTTGAGCTCACAGGACAAATCACTCACATTCTTCCTGTTATGATTGCTGTTTTGATAGCTAATGCCATTGCACAGTGGTTACAGCCATCATTTTACGACAGCATCATTCAAATCAAGAGGCTTCCATACCTTCCTGACTTAACAAAAACACAGGTGTACAACTTGCTTGTCGCTGATATAATGAAGACCAATCTTTTCTACATCTCATATCATTCTAAATACGCTGACCTCAAGGAACTACTGGAGAAGTCACGTCACCGTTCATATCCATTAGTGGATTCTGAAGATTCAATGATCCTCCTCGGCTCTATTCAGCGACCTCAACTACAGTCTCTATTAAATCAACACATGCATAAGATGTTCCAGGCCAGCAGCAATGCCGAGAGTGAAGATGCGTTATACAGTGCGAGAGCAGAAACGCCAGATTCATTACAGTTACAGTCTGACGAACAAAGCAGTGATGACCAGGGACCTCCAGCAAAACTAGAAGTCTTAGTGTCAGCTGAAATATCATTAAAAAAACAGGACACTCTACCTCAGAGTCATAAATCTTCAACTGGAAAGTCTTTGTTAGAGAAAATTCCAGTTCCTACAAGACTTCACAGACTGTTTGGTAGTGGATCAGCCCTTAACGATGCTGAGAAAATTGCTGAAGCATCTGACAAAGACAGTCCAACTGGAGATCAGCAAGCTCAATGGGAAAAGGAACTGTTACAGAGACCGATAGATTTCAGCAACTGTCAGATTGATCCATCACCATTTCAGTTGATCGAAAGAACATCATTGTTAAAGGTTCACAAGTTGTTTGCGCTTCTTAACCTGTCACATGCCTATGTAACCACTCTGGGACGACTGGTGGGCGTGGTGGCTCTCAAAGAGGTCCGGCAGGCAATTGAGGGTGAGCGGTTTCTGGATGCCTCCCATGTAGATGCAGTTGACACGGACCATGGCAACAGTTTTATGTCAGCACAGGAAGATGTTATGCTCAATTCGCACCCTGAACCCAATGCCGCTAGCGAAGAGTCTGATCCTGTACTGTAA

Transcript

OS493_006595-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9WU45	Chloride channel protein 2 OS=Cavia porcellus OX=10141 GN=CLCN2 PE=1 SV=1
P51788	Chloride channel protein 2 OS=Homo sapiens OX=9606 GN=CLCN2 PE=1 SV=2
P35525	Chloride channel protein 2 OS=Rattus norvegicus OX=10116 GN=Clcn2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004432 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00571 all species →	CBS	CBS domain	Domain	Interproscan
PF00654 all species →	Voltage_CLC	Voltage gated chloride channel	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000644 all species →	Domain	CBS domain	Interproscan
IPR046342 all species →	Homologous_superfamily	CBS domain superfamily	Interproscan
IPR001807 all species →	Family	Chloride channel, voltage gated	Interproscan
IPR014743 all species →	Homologous_superfamily	Chloride channel, core	Interproscan
IPR050970 all species →	Family	Voltage-gated chloride channel	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45720 all species →	CHLORIDE CHANNEL PROTEIN 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005247 all species →	Molecular Function	voltage-gated chloride channel activity	Interproscan
GO:0006821 all species →	Biological Process	chloride transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05011	CLCN2; chloride channel 2	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006595-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

47.0Max TPM

17.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.59	20.76
polyp at pH7 6	18	18	13.34	23.56
coral polyp · control treatment	16	16	22.54	47.05
coral polyp · oil and dispersant treatment	16	16	21.60	36.01
coral polyp · oil treatment	16	16	19.12	32.26
coral polyp · dispersant treatment	16	16	21.24	36.33
Polyp	10	10	7.98	13.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.76
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.85
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.70
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.23
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.02
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.31
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.69
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.39
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.31
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.97
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.74
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.63
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.15
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.94
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.48
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.71
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.70
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.66
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.34
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.18
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.21
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.94
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.79
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.72
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.13
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.63
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.24
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.09
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.33
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.30
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.05
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.02
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.73
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.30
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.09
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.83
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.97
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.54
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.67
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.02
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.91
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.53
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.19
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.25
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.30
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.31
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.80
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.23
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.89
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.66
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.22
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.89
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.21
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.94
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.93
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.87
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.11
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.23
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.94
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.26
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.95
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.60
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.04
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.02
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.12
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.29
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.07
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.79
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.55
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.68
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.32
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.20
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.10
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.70
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.00
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.52
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.03
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.49
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.55
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.09
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.42
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.63
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.81
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.66
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.36
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.85
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.99
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.66
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.37
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.54
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.15
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.53
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.68
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.69

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.