Gene detail

Detailed information of OS493_006857-T1 in Lophelia pertusa

Genomic Location: scaffold_14:3091502...3129042
NR annotation: KAJ7386827.1, hypothetical protein OS493_006857 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006857-T1

ATGCCATCTGGGAAGGATCGTAGCAAAGAAGACACATGGAAAGAATCTGATCTAAAGAAAGCCTTGAAGGATGACAAGAAAAAGCCCAAAGATGAGAGCAGAAAATCCAAAGAACACTCCAGTCGTAAGTCTGAGCCAGATAAAAGAGAACGGAAGGACAAAGATGATGATAGAAAGAGAAGGGGTCATGATGACGACAAAAAGAAGAGAAAGGAAACCAGTGAAAGAAGCAAAGATTCAGAAAGGTCAAAAGAAACTTTAGATGTTGAAAGATCAAAAGAAAGAGACAGAAGTAGAGAAAGGCGGAAAGAAAAGGAAAGTGGTGATAAAGAACATGATAGGGACAGAAGAAGAGAAAGAGATGCAGAGAAGAGTAAAGACAAGGAGAGAGGCCGTGACAGAAGCGACAGAAATGGTGAACGAGACAGAAGTCGAGACAGAAGAAAAGAGAAGAGTGGTGAGGACAGAGATAGGGAACGAAGAAAAGAAAAAGAAGGTGAAAAGAGGGGAGAAGCAGAAAGACGTGAAAGAAGCAGAGATAGGGACACAAGCAAGGAGAGGAGGAAAGAGAGGGACGACAAGGATAGAGGAAAAGACAAGACAAAGGACAGGGATAGAGACAAGGACAGAGAACGACGGAAGGAAAGAGACAGATTGGATAAAGAAAATAAAGATTCTGACAAAGACGATAGACGGAGAAGTGATAGAGACTCCGATAGAAGGAAGGATCGGTCGAAAAATGAAGATGGCTCAAAAGAAAGACGACATGATGATAGAAAGGACGAAAGAAGAGAAAGAAAGGATGATCGAGACAGACATAAGGAAAAAAGTGAGGAATCTAATGGTAGAGATAAAGAAGACAAAATAAAGAGAAGAGAAAAAGAAATGATGCAGTCTTTAAAAAAAGAAGAGGAATTAAAGAAGAATCCCAAATTGAAATTTAGATCAGATACAGTGGAAGAGGCAGATACCATAGATGAAGATGTTGAACAGAAAAGGAAGGCCTCATTACGAAGAATGTCATCCACTGGTGCTGCTGAAGAAATCCACGATGAAGAGAATGATGGTTATGACTATGAAGATGATGACTTTGAGGATTATGATGACGATTTTGAAGATGACGCAGATGAAGAGGGAGATGATGAAGAGGCAAGTATTGATGTGCAGGATCACTCTGGAATGCAGGAGCTTCTACAAGCAATAAATGCAGAGAACCAGGATGCAAGAGCTTCGTCCAGAGAGGGCAGAGAAGAAACAAAGGAACATTCAGAACCATCAACTAAAGAAAAAGTACGACCTACCACTGGCAGTCGTGGAAGGATAAACTTTGTTGCTGCCAAGCAGAAGCAAATCACTGATAAAGTTGCTTCAAGGACAAGAAGGAGAGGGCAGGAGTTGATGCACTTGATTGACCTCGATGTTGCAGTTTTTGATATTTTTGATTTGCCACCACTCAATGAGTATGAGCTGTACATAAAAAACTTTGGACGATCTGACACTAAACAGGCATATGTTCAATGCAATGAAGATAATGTTGAAAAAGAGGTACAAACAGAGGAAATTGAGACGAGAACAAAATGGACACAAAATCCTGCTAGCGATTCGGCTGGTTTTGGAGACGATGAAGATGATTTGCAGGAGGATTTATCCAGCTTAACAGAAAAGGCGAATATCGATAGCTTAAGACTGTCCAAATTCCTTCAGCGGGCTACACAGACATGTTTAATCTTGCTGGAAGAGAACATTAGTGAACAGGCCAACACTCAGTTTAAAGAAAGGAAAGATATGACTTGTAGTGATGGCTTTATTCAGCTAGCAACCAAACACGTCTATCTTGAAGGTCGTCCAGTCAAATGTGTTCATATATCTCCAGTCCAAACCCACTTCGTACTTGTTGCTTATGGTCCAGTGAAAGATCAGAGCAAAGTTACTTCAAAGATTCATAATAGCATCCAGGAAAAGGGCCTTGTGTGCTTCTGGAACACCAATGAGCCCTCTGAACCACAAAAAGTTTTAATCTGTGAGTCTACACCGATGTGCTGTTGTTTGAGTCCTTCTAAGGCAACTTTAGCGTTTGCTGGCTTGGAGGATGGATCACTGGTAGCATGGGACTTACGAGAGTCTTCGCTGATGCACTACTTTTCTAGAATATCCGTTGGAGACAATGAAATAATCTTAAGGCCGCCCACGTTTAGCACAGCTGGCGTGTTGAAAAAGACGAGAGCCATCTTAGTCCAGTTGTGTCAGTACTTCCCGTCGTCATGCCTGGTGACAGCAGCAACGAGTGCAAGGGCATCTGGAGGATCAAACCTAATGTCAGATGATATGTTAGGCTTATCTTTCCAACTAGCTACTTTAGAAGAAAATGCTGCAATTTATCTTTGGGTTGTTGTGGAGCTTGATAGAGCGAACAGCGCAGGCTCAGAGTCGGATCTAGGTTTGTCTCCTGGAGGAAAAATTAAGCTTATGAAAAGCTCTTCAATATCTCTTCAATCACCTTTTAGGGATTTCCGCAGCACAATGAGTTTGCAGGCGCTGATAATGAGGTTTCTTCCACATGATCCTAATCATATTTATGTCGGCACAGATGGAGGTTATGTTCTTCATTGTGAAAGGCACGGTGGTCGGGCCCCTCCAAAGGCGCACAGACCTGTTATTGAGAACTTAGTAAACATTGCATCTCTTGACTTGTCTCCGTGGCAGTTACCCTGTATGCTGGCAGGAAGTGAGGATGGTAATCTGTGGCTGTTCAACTTAAAGAACGAATTGCCGCTGCTGAGCTGGTCTACATCCACGGGTGGCAGTGGGATATTATCAGTGCAATGGTCTCGAAGCAAACCTAGTGTATTTTATGTGTTGGATTCAAATTCTAATCTGCATATCTGGGATTTACTTAAGAGTGATCAAGGTCCAGTTTCTGTTGAGACCTTTAAACATGGACGTGTTGCATGTTTTGAGCTGTCCAGTGATTATTCAGCTTCAGGAATTGGAATTCCTGGAAGAAACCCTGAGCTGGTGTTAGTGTACGAAAGCGGAGCGGTGGAAATTCACAAACTAAGCACTCTGTTCTCCAGAGCGACCGGGGATGAATTGGACACGTTTGCTAGCTATCTGGACAGGGTCATATGA

Transcript

OS493_006857-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8C761	Cytoplasmic dynein 2 intermediate chain 1 OS=Mus musculus OX=10090 GN=Dync2i1 PE=1 SV=1
Q8WVS4	Cytoplasmic dynein 2 intermediate chain 1 OS=Homo sapiens OX=9606 GN=DYNC2I1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003649 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_006857-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR042505 all species →	Family	Cytoplasmic dynein 2 intermediate chain 1	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16022 all species →	WD REPEAT DOMAIN 60	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005868 all species →	Cellular Component	cytoplasmic dynein complex	Interproscan
GO:0042073 all species →	Biological Process	intraciliary transport	Interproscan
GO:0045503 all species →	Molecular Function	dynein light chain binding	Interproscan
GO:0045504 all species →	Molecular Function	dynein heavy chain binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22869	WDR60; WD repeat-containing protein 60	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006857-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

107.5Max TPM

20.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.48	20.58
polyp at pH7 6	18	18	13.65	21.23
coral polyp · control treatment	16	16	31.22	107.49
coral polyp · oil and dispersant treatment	16	16	30.80	78.98
coral polyp · oil treatment	16	16	24.83	37.26
coral polyp · dispersant treatment	16	16	19.63	36.30
Polyp	10	10	12.76	17.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.58
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.67
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.24
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.60
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.31
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.86
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.78
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.68
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.67
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.54
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.36
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.21
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.66
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.60
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.24
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.08
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.23
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.70
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.77
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.80
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.21
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.05
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.95
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.70
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.23
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.02
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.66
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.54
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.52
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.11
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.53
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.65
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.43
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	107.49
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.84
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.11
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.96
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.82
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.86
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.47
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.80
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.99
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.44
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.13
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.25
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.42
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.81
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.89
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.98
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.48
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.98
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.65
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.60
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.28
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.26
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.60
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.38
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.45
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.96
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.59
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.38
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.56
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.26
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.75
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.29
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.09
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.44
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.83
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.69
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.40
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.12
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.60
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.69
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.65
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.54
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.10
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.30
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.40
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.89
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.94
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.12
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.81
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.10
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.43
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.43
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.50
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.91
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.29
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.73
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.79
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	15.59
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.37
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.40
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	13.12
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.93
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	10.45
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.40
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.35

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.