Gene detail

Detailed information of OS493_006951-T1 in Lophelia pertusa

Genomic Location: scaffold_14:4320211...4327726
NR annotation: KAJ7386916.1, hypothetical protein OS493_006951 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_006951-T1

ATGCCACTCCTGAAGAGTGATCTCTATGCAACCCTAATGGAATGTGTGAATGGCGACCTTAGCCTGTCTCTACCCTTGTGGCATGTGGATAGATATGCCGTGGGTGTGGTTGTGGCAAGTGGTGGGTACCCTAGTGCAGTGAAGAAAGGGTGTGTCATTCAGGGATTGAATAACTTAGAGAATCTAGACAACGTGGTGGTGTTTCATGCTGGGACAGCCATCAAACAGAATGAAGGTGAAGAAACCGTGGTAACATCAGGCGGCAGAGTGATGGCGATTGTTGGATTGGCACAACATATAGAAGATGCTCAGAAAACAGCTTATGAAAGTATCAAGAAGATTGACTTTGATGGTATTCAGTACAGAAATGACATTGCATCTAGAGCTTGCAAACCTAAAGGCTTGATGTATTCTGATGCTGGAGTGGATATAGATGCCGGGAACCTTCTGGTAAAAGCTATCAAGCCATTGGCTGCGTCGACAGCTCGCACGGGTTGTACCGCAGACCTCGGTGGCTTTGGAGGTTTCTTTGATCTCAAGGCTGCTGGCTACACAGATCCTTTGCTTATCAGTGGTACAGATGGAGTAGGAACTAAACTCAAGATTGCGCAGGCTGTTGGCATGCATAGTTCAGTGGGCATTGATCTGGTTGCCATGTGTGTGAATGACATCCTTGCCCATGGTGCCGAGCCTCTGTACTTCTTGGACTACTTTGCTACTGGCAGGCTGGACGTGGGCGTCGCCAAGGAGGTGATTCGTGGCATAGCACAAGGCTGTTCACAAGCTGGATGTGCTCTTTTGGGAGGCGAGACTGCGGAAATGCCAGGGATGTATTCATCCGGTGAATATGACATTGCTGGATTTGCCGTTGGTGCAGTTGAGCGCGACAAAGTTCTTCCTCGCTCACAGACTATCACTGCAGATGATGTCATCATCGGTTTAGCTTCGTCCGGCATCCACAGTAATGGGTTCAGTTTAGTGAGGCGGATCATCGATAACTCTGGATTGAGTTACAGTTCACCCAGTCCATTTACCACTACTGAAGGGCTACAGTCTGTCACTAAACTAGGTGAAGCTCTTCTTGCACCGACCAGGATTTACTGCAGTGCGGTACTTCCTCTTATGCATGATGGAAAGGTCAAGGCCTTTGCACATATAACAGGGGGAGGTCTGACTGAGAATATTCCACGTGTCCTCCCCTCTGGTGTGGGTGTGTCACTAGATGCCAGTTTGTGGACTATGCCTCCTGTGTTTGGCTGGCTATTCGGCCAAGGAAACGTTCCAACACAAGAAATGGCCCGCACCTTTAACTGCGGCATTGGAGCAGTCCTTATCGTAGGAAAAGACATTGCTGACTCAGTAATGGAACATTTCAAAGCATCTGATGAACAGGCTTGGATTATAGGAAAAGTTACTGAATGCACAGATGACAGTAATAGAGTGGTTGTTAAAAATCTGGAAGATGTGCTTTGCGAATCTGCAGCAAAGGCAGATATCAAAGGGCAGAATATTACAAGCAGATCTGTCAATGGTCCAGTTAAAAGGCCCAAACTTAGCAATGGACAAACACAACAACACAAGAAAGGCCAGGAAATGAAAGTGGGTGTCCTTATCTCGGGCTCGGGAACAAACTTACAAGCACTGATTGATCACAGCTTACAACGGGACAGCTGTGCTAAGATTGCATTGGTCATTTCAAATGTGCCTGGAGTCCAGGGCTTGACGCGGGCTGAAACAGCTGGTATACCAACCAAAGTAATTAAGCACAAAGAATTCAAGAGCCGTTTGGATTTTGATATGGCTGTACATGGAGCATTAGAGGAGGCTGGGGTGGAGCTGGTTTGTTTGGCGGGATTTATGAGGATTGTAACGGGAGAGTTTGTTCGCAAGTGGCATGGCCGTCTGCTCAATATTCACCCTTCATTGCTGCCCTCCTTCAAAGGAATGCATGCGCATCAACTTGTGCTGGAGGCTGGCGTTTGTATATCAGGCTGCACTGTCCATTTTGTTGAGGAAGAGGTAGATGCTGGAGCAATAGTGACTCAAGAAGCAGTTCCAGTGTTGTACGGAGACACAGTTGAAACACTACAAGAACGAGTGAAATGCGCCGAGCACAGAGCTTACCCGAGAGCCATGGAGCTTCTGGCTAGTGGCAGAATCAAACTAAACGACGACAATAAAGTACAGTGGATGTGGTAA

Transcript

OS493_006951-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q64737	Trifunctional purine biosynthetic protein adenosine-3 OS=Mus musculus OX=10090 GN=Gart PE=1 SV=3
P21872	Trifunctional purine biosynthetic protein adenosine-3 OS=Gallus gallus OX=9031 GN=GART PE=1 SV=1
P22102	Trifunctional purine biosynthetic protein adenosine-3 OS=Homo sapiens OX=9606 GN=GART PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002833 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02843 all species →	GARS_C	Phosphoribosylglycinamide synthetase, C domain	Domain	Interproscan
PF00586 all species →	AIRS	AIR synthase related protein, N-terminal domain	Domain	Interproscan
PF02769 all species →	AIRS_C	AIR synthase related protein, C-terminal domain	Domain	Interproscan
PF00551 all species →	Formyl_trans_N	Formyl transferase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036477 all species →	Homologous_superfamily	Formyl transferase, N-terminal domain superfamily	Interproscan
IPR020560 all species →	Domain	Phosphoribosylglycinamide synthetase, C-domain	Interproscan
IPR004607 all species →	Family	Phosphoribosylglycinamide formyltransferase	Interproscan
IPR004733 all species →	Family	Phosphoribosylformylglycinamidine cyclo-ligase	Interproscan
IPR001555 all species →	Active_site	Phosphoribosylglycinamide formyltransferase, active site	Interproscan
IPR036921 all species →	Homologous_superfamily	PurM-like, N-terminal domain superfamily	Interproscan
IPR011054 all species →	Homologous_superfamily	Rudiment single hybrid motif	Interproscan
IPR037123 all species →	Homologous_superfamily	Phosphoribosylglycinamide synthetase, C-domain superfamily	Interproscan
IPR016188 all species →	Domain	PurM-like, N-terminal domain	Interproscan
IPR036676 all species →	Homologous_superfamily	PurM-like, C-terminal domain superfamily	Interproscan
IPR010918 all species →	Domain	PurM-like, C-terminal domain	Interproscan
IPR002376 all species →	Domain	Formyl transferase, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10520 all species →	TRIFUNCTIONAL PURINE BIOSYNTHETIC PROTEIN ADENOSINE-3-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0009058 all species →	Biological Process	biosynthetic process	Interproscan
GO:0004637 all species →	Molecular Function	phosphoribosylamine-glycine ligase activity	Interproscan
GO:0009113 all species →	Biological Process	purine nucleobase biosynthetic process	Interproscan
GO:0004644 all species →	Molecular Function	phosphoribosylglycinamide formyltransferase activity	Interproscan
GO:0006189 all species →	Biological Process	'de novo' IMP biosynthetic process	Interproscan
GO:0004641 all species →	Molecular Function	phosphoribosylformylglycinamidine cyclo-ligase activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006164 all species →	Biological Process	purine nucleotide biosynthetic process	Interproscan
GO:0046084 all species →	Biological Process	adenine biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11787	GART; phosphoribosylamine--glycine ligase / phosphoribosylglycinamide formyltransferase / phosphoribosylformylglycinamidine cyclo-ligase	EC:6.3.4.13 EC:2.1.2.2 EC:6.3.3.1	Antifolate resistance	ko01523	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_006951-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

23.4Max TPM

7.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.28	16.34
polyp at pH7 6	18	18	10.74	19.66
coral polyp · control treatment	16	16	6.93	11.33
coral polyp · oil and dispersant treatment	16	16	4.54	14.23
coral polyp · oil treatment	16	16	6.16	10.53
coral polyp · dispersant treatment	16	16	6.60	18.08
Polyp	10	9	7.57	23.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.34
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.85
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.19
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.03
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.54
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.24
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.12
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.99
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.84
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.67
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.17
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.11
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.48
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.22
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.07
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.64
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.66
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.10
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.35
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.55
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.66
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.42
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.70
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.18
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.02
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.96
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.12
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.97
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.86
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.80
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.57
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.82
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.33
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.07
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.74
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.33
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.45
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.90
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.18
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.65
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.36
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.72
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.33
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.80
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.93
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.23
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.18
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.65
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.20
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.84
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.36
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.28
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.66
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.50
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.05
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.66
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.37
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.55
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.41
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.53
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.73
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.25
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.08
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.84
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.25
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.14
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.39
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.21
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.70
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.01
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.52
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.39
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.08
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.66
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.26
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.85
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.37
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.80
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.76
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.48
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.32
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.94
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.68
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.63
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.82
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.83
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	23.37
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.87
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.85
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.67
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.79
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.67
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.20
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.59
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.