Gene detail

Detailed information of OS493_007078-T1 in Lophelia pertusa

Genomic Location: scaffold_15:1042098...1044765
NR annotation: KAJ7380709.1, cyclin-dependent protein serine/threonine kinase inhibitor [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_007078-T1

ATGGTGACAGGCTGTCATGATGGAGGAGTAGTCCAAGCAAACAAACGAACCTTATCAAAACTGTGGAATGCTTGTAAATATGGCGACGTAAAAACAGTTGAAAAATTAGCAGTCAAAAAGGTCGGTGCTAACGCAAAAGCTCATGGCATGGCTCTCATTCACATAGCTGCGCGATATGGAAACCCGGATACTGTCAGGTATCTTCTCTCCTTGGGTGCCAATGCCCATTCTGTGGACGAAGAAGGTTGGACGGCTCTACACTGGGCAAGTGCTGGTGGACATGTAACTGTTATGCAACTTCTGTTTGTGCATGATATTGACCCCAACGTGAAAACCAAAACCGGAGCCACACCGCTACACTTAGCTGCTTCCAACGGCCATGAGAAGGCCGTGAACCTCCTTCTGACTTTCGGTTGCAACGGAAATGTCTTGGACGGAAATGGCAGGAGTTCGATGTTTCTAGCAAGCAGAGGTGGCCATGTTCCCGTCATAGAAGTTCTTCTGAAACACGGAATTAAATCCAACGTGCCAATCAAAAATGGTCCTACCCCAGTGCATACTGCAGCGAGAAATGGTCATTCAAAAGCTGTTGACTTTCTTATTTCTTGTGGAGCGGATATTGATGTAGTTGACAAGGATGGATGGAACGCCCTACATTCTGCGTGTCAAAATGGTCACGTTGACGTGGTAGAAACTCTTCTCAAAAGCGGTATGGAGGCAGACAGTAGAATCCACGGAGGTTGCACTCCTCTTATGATTGCAGGTTGTCACGGGCATCCAGACGTGGTGGAGTTTTTGATCTCTAAAGGAGCTGATCCAAATTCCTCTGATAAGTGTGGGTGGACCGCTTTGCATTTTGCCAGCCTCGGAGGCCACGTACCCGTCATTCGAGCGTTGCTTAAAGCAGGGGTGGATGTCAACATTCGCACTACTCATGGAACAATTCCCATTCATATCGCGGCTCGTTACGGCCAACCTGAAGTAGTGAAGTATCTCATGAGGAAAGGTGCTGATCTGCAGGCCACCGATAACGATTATTGGACAGTAATTCATTACGCCACTCAGGGCGGTCGCCTTCCTTTCCACGTCATGGAATCAATGTTAAATCAGGGTGTAGATATAAACGCCAAGTCAGTGTTAGGAATTTCTCCATTGCATATTGCAGCCCGCCATGGTCATCCAGATTTCGTGGATTTTCTTCTGTCTCAAAATGCGGACCTCTTGGCTCAGGACAATCAGGGATGGACTGCCTTGCACCATGCCTGTAAAGGTGGTGAACTATCAGTTGTCGAGAAATTGTTTAACAAAGGGATCGATCCAAACGTCGGAACATTTTCTGGATTGACTCCCATCGGAATTGCAGCTTTGCGGGGAAATCAGGAGTGTATCAAGTATTTACTTTCTAAGGGTGGTGACCTAACTGTTGTAGATAACGAAGGCATGACTGTGCTTCATTTTGCCAGTCAAGGAGGACAGGCTGACTTGATAGAAACATTACTGAATTACGGAATGCAGCCAAATGTTGAAGCGGACAAGGGTCTCGTACCCATTCATTCCGCGGCGTTTAATGGTCACGCAAGTGCTATAAACTTACTTGTTTCAAAAGGAGCAGATCTTAAGAAAACAATACTCGAGCTCGGCTTGGACCCCAATGACAGAACGGCAAACGGACGAACTCCTCTTAGTATTGCCACGATACACGACCAGCCAGAGGCGGTAAGATTGCTACTCTCAAAGGGAGCCGATGAGCACCTGGCCGACAATGAAGGATGGAATGCTTTGCATATCGCGAGTGATCATGGTCACGTGACCATTCTTGAGCTGCTCTTGGAACTCGGTGTAGAGGTGGACTGTCAAACAAACGAAAATTTAACTCCGTTACTTCTTGCTGCTAAGGGAGGACAAACCGAAGTCATAAATCCCCTGTTGTCACATGGGGCCAATCAAGACGCTACTAACAATGAAGAATGGAAGGCGTTACATGTAGCAAGCCTCGAGGGTCACGTGAAAGTCGTAGAAACCCTACTAGAGAATGGAGTGGATCCAAATCAGAAGACGCAAAAAGGCGTGACCGCCATGCACTGTGCAGGATTAAACGGGCACAATGACATTATCAACTGCCTCTTAGAACGAGGTGGCAACATTTACGAGATTGATGGTGAAGGATGGAATACTTTGCACTACGCCTGCAGAGGAGGCCATGAAAAAGTAATCGAACGGCTGAAAAAGCTAGGCATGCAGTTAAACTGCCAGGCGGGAGACGGTTCAGTTCCCCTACACATCGCCTCCCGCTACAGTCACCCAGAGTTAGTCAACTTCTTGCTAACGCATGGAGCTGATACGCATGCTGTGGATAAGAATGGATGGAACGCCCTTCATCATTCAGCCAAAGATGGAACAGTGGCAGTCGCTGATGCTCTCCTCAAACAAGGAGTGGAGATGATCGTGAAGCGTACTCATGATGGCGATACTGCGATGGGTATTGCCGAAAAAGAAGGCAACAAAGATGTCCAACAGTTTCTAAATAGCTTCGTGTCCAATCACTTGGGGATTTCAAGCGACGAGGACAGAAAACATGGAAACTACTGCATCATCCTGTGA

Transcript

OS493_007078-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009510 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13637 all species →	Ank_4	Ankyrin repeats (many copies)	Repeat	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24198 all species →	ANKYRIN REPEAT AND PROTEIN KINASE DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_007078-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_007078-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

33.2Max TPM

5.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.36	21.15
polyp at pH7 6	18	18	3.67	8.79
coral polyp · control treatment	16	16	9.90	33.22
coral polyp · oil and dispersant treatment	16	16	3.06	6.63
coral polyp · oil treatment	16	16	4.73	13.36
coral polyp · dispersant treatment	16	16	4.31	12.13
Polyp	10	10	6.96	14.04

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.15
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.08
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.38
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.80
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.64
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.99
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.23
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.83
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.47
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.95
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.68
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.54
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.06
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.81
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.31
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.79
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.62
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.95
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.58
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.33
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.32
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.19
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.71
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.89
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.83
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.50
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.38
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.26
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.24
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.22
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.69
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.90
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.18
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.41
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.80
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.55
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.97
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.91
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.79
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.33
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.10
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.44
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.32
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.45
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.43
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.63
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.33
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.33
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.98
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.42
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.78
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.64
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.77
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.44
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.36
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.26
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.53
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.67
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.17
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.38
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.47
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.35
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.16
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.09
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.21
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.21
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.85
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.13
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.24
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.27
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.24
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.42
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.70
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.86
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.66
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.22
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.72
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.68
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.63
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.46
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.90
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.39
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.04
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.04
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.61
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.33
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.02
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.97
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.63
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.41
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.12

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.