Gene detail

Detailed information of OS493_007237-T1 in Lophelia pertusa

Genomic Location: scaffold_15:3754462...3771036
NR annotation: KAJ7380846.1, hypothetical protein OS493_007237 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_007237-T1

ATGTACGGGATGCTCTTGGAGAGCGTGGAACATTTTCTTAAGGAGAAATACGGCGAAAAGACTTGGAATTTGATTCGTCTTCGCGCTGGAATCAAACAACACGTATTTGTCACTCACGAACGGTATCCCGACAACCTCATCTTGGATATCGCTTTTGCCGCAGTGGACGTGATTGGGAAACAAACTAAAATGACGGCGGATGATTTTATCAAATTCTTTGGGACTTGCTTCGTGAAATTTTTCAGCAACTACGGCTATGATAGAATCATTCAAGTGAGTGGAAGATACTTTAGTGATTTTTTGAGCGGGATTGACAACTTACACGAGCACATGCGCTTCGCCTATCCAAAGCTTATGTCGCCGACGTTTTACTGTTCTGAAGAAACAAGCGCAGGATTGCTTTTACACTACAAATCTAAGCGCCATGGATTTGAACACTACGTCGTTGGGCAAATTATGGAAGTGGCCAGAGCGTTTTACGGTATAGCTGTGGAGATGACGGTTCTTAACAATATTTCGACCGAAACCGGTTGTCACGTCATTTACCGACTTAAATTTGACAACTCTGCCTTTAAACCGCATTCCCCGGATGTTTTGTCCGTTGAACAAAATCGTGATTTCACTTGCGAGGCTTTCTTCCATATCATGCCTTTCAGTTTCATCGTGACGCCTAACATGAAGATCTACATGACCGGAGAGGCTTTGGCGTCAACGCTTGGCAACGTTCTAATCGGGAACCGCGTGGATGCAGTTTTTACACTCAGACGACCGCGGCGTGAATTTTCGTGGGGAAACATTAAAACATGGAATGTCATCTGCGAGCTAGTTGCGAAGCTACCCTGTGTGAAAAACCACTGCCTTAAAAAGCCACTACTAAGATCCGTCAAATCTGTGGATAAAGCAGAATATATTGTTCCCAAGGAAACGAATCACAGGGCGGAGCTTCGAACGATTCTGGAGGAAAATAGACGTCAAATCAGCTTTACAGGGCACAAGAAGTCAAGACGACATAGTGACGTTGACAGAAAGAGTTCTTTACTGCCGAGGTTGTGTGGAAATGATTATTACTCGACTAAAGTCTTGAAACCATTACATCTGAAAGGCCAAATGAAATACCTGAAGAAACATGACATGGTACTCTTCGTCTGCTCACCCATGATAAGCAGCGTAGAGGAAATGGCGCGTACCGGAATGTACATGAGTGATCTGGGAATGTATGATTCGTCGCAAGAAATGGTTCTTTCTGGAATCCAGCCTCTCCCAGAGCTTGAGTATGCTCGCGATCAGCTTTTAGATCGCGGAAAAACTCTGGAGGAGAATTTAGAAAAACTGGATGAAGAAAGGCGGAGAAGTGAGGAATTGTTATATCGTATGATGCCTAAAGCTGTAGCTGATCGATTGAGAGATGGACAAAAAGCTGTTGAAACATGCGAGCATTTCGATAGCGTTACCATCATGTTCAGCTACTTGGATGGTTTTGACAATATTTGCGCCAATGTGATGCCAATGGAAGCCGTTAAACTGGTTAACAAGATGCTTGTAACTTTTGACAAACTAAGTGAAAAACACGACGTTTACAAGTTTGAGACCCTTGGGGACGCGCAATACATGGTGGTGAATGGTGTACCAGTCAGGAAGGACCGACATGTCGAGCCCGTGGCTTCAATGGCCCTGGATATTCTAGGGTCTGTAAAAGAACTAAAAGATCCTACTACTGGGACGTCATTAACTGTTAGTATAGGAATACACTTGGGTCCAGTAGCGGCGGGTCTTGTTGGAGAGAAAATGCCACAATATTGTCTGTTTGGCGATAGTGTGAACATTGCGGCAAGACTCAGAACTACCTCGTTGCCAATGAGGATTCATATCAGTGAAAGCTGCAACGAATGCTTGAAAGGGACAGACTTCGAAACAGAGTTTCGAGGATTAATAGAACTCAAGGGAAAGGGAAACACAAGGACCTATTGGCTGTTGGGAAAGAAAGAGACAACTCAAACCCAAATAAAAGGCTCCGAGGAACTAACTAACAGCTGA

Transcript

OS493_007237-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8INF0	Soluble guanylate cyclase 88E OS=Drosophila melanogaster OX=7227 GN=Gyc88E PE=1 SV=4
Q86C56	Soluble guanylate cyclase gcy-31 OS=Caenorhabditis elegans OX=6239 GN=gcy-31 PE=2 SV=2
Q9VEU5	Soluble guanylate cyclase 89Db OS=Drosophila melanogaster OX=7227 GN=Gyc89Db PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001391 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07700 all species →	HNOB	Haem-NO-binding	Domain	Interproscan
PF07701 all species →	HNOBA	Heme NO binding associated	Domain	Interproscan
PF00211 all species →	Guanylate_cyc	Adenylate and Guanylate cyclase catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001054 all species →	Domain	Adenylyl cyclase class-3/4/guanylyl cyclase	Interproscan
IPR029787 all species →	Homologous_superfamily	Nucleotide cyclase	Interproscan
IPR038158 all species →	Homologous_superfamily	H-NOX domain superfamily	Interproscan
IPR011644 all species →	Domain	Heme NO-binding	Interproscan
IPR024096 all species →	Homologous_superfamily	NO signalling/Golgi transport ligand-binding domain superfamily	Interproscan
IPR042463 all species →	Homologous_superfamily	Haem NO binding associated domain superfamily	Interproscan
IPR011645 all species →	Domain	Haem NO binding associated	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45655 all species →	GUANYLATE CYCLASE SOLUBLE SUBUNIT BETA-2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0009190 all species →	Biological Process	cyclic nucleotide biosynthetic process	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0004383 all species →	Molecular Function	guanylate cyclase activity	Interproscan
GO:0008074 all species →	Cellular Component	guanylate cyclase complex, soluble	Interproscan
GO:0019934 all species →	Biological Process	cGMP-mediated signaling	Interproscan
GO:0038060 all species →	Biological Process	nitric oxide-cGMP-mediated signaling	Interproscan
GO:0070482 all species →	Biological Process	response to oxygen levels	Interproscan
GO:0020037 all species →	Molecular Function	heme binding	Interproscan
GO:0006182 all species →	Biological Process	cGMP biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_007237-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_007237-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

11.0Max TPM

4.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.60	7.15
polyp at pH7 6	18	18	5.14	10.50
coral polyp · control treatment	16	16	4.28	7.61
coral polyp · oil and dispersant treatment	16	15	4.80	11.02
coral polyp · oil treatment	16	16	4.55	6.32
coral polyp · dispersant treatment	16	16	6.21	9.90
Polyp	10	10	4.73	7.35

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.15
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.67
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.43
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.10
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.61
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.43
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.95
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.56
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.54
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.50
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.37
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.16
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.05
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.99
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.20
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.75
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.92
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.96
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.85
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.04
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.19
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.91
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.87
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.27
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.24
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.57
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.61
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.29
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.40
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.38
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.93
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.42
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.33
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.93
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.37
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.87
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.18
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.04
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.02
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.53
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.13
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.78
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.52
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.70
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.52
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.27
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.26
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.04
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.32
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.21
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.63
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.14
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.12
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.67
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.66
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.45
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.74
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.66
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.57
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.90
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.80
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.66
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.36
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.82
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.51
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.75
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.32
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.24
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.12
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.06
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.69
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.47
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.39
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.80
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.25
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.12
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.08
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.32
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.80
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.71

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.