Gene detail

Detailed information of OS493_007378-T1 in Lophelia pertusa

Genomic Location: scaffold_16:1672222...1674243
NR annotation: KAJ7374293.1, hypothetical protein OS493_007378 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_007378-T1

ATGTCTGTCGAGGCGAGGATTTTGGATTCCCTGAGGCCCATATTTCCGCAGCTGAATGACCGCGTTTTGTCCTTGTGCATCAGGAATGTGCAAGAAACGGTGGGAAGCGATCCCGCCACGATCATTCCGGGATGCATTGATTTGCTTTTGGATGGAACTTTTCACGAAGTAGACTTACCAGAGCACAGATTACCCACTTCGGCGACTCCTTCACGAGAAGACGAAGCAAATTCTCGCTTTGTAAGGGACGATGACGATGTAGTGATTGTCTCGACTAACCTCCCAGCGAAAGTGATCGGAGCTCCAGTCATCATTGATGATCCCGGAGTTCCTATATACAACACGCCGTCCATCTTGAATAATTCGACGACACCATCTCCCCGCTTGCAAAACGCTGGGAATAAAGTAGCAGACACGAGAAGAAATTTATCGTTTGGAAGGGACACACCTTCGTCGACTGCTACAACACCTATTTCGACGAACACGGTTGATCCAGGTCGACAAGTTCCAATTGTTCATGTCCAACCCCCCTTGGACCCGATGGAAGAAGCCCTGAAAAACCTCCACTCTTTATTCCCCGATGTAAAAGACGATTATCTTCAGAGTTTGCTCGATAAGTGGTCTCATATCCCTCCCAATGAGGCTATCAACAATGCTTGTAATGAGCTGTTGGAGAAAAATGATTACCCAAGAAAATCAGCCATTTTGTCAGTTCCACCAACCAAGAGTCCTGTTGAAGTCCAGAAAGAAAAAGACTACATGAAAGATTTTTCTAGCCATGTATCAAGAACATATGCATTACAGTGCTTACAATTACTGCAAAATGACTTCAGGATGATTCCTGTTAAATACATTAGGATGGGTTTGGCCAGGTTCAGGAATCACTATGCACCAAGCAGGAGTTACTTGCAAGAGCAGCTTCGTGTGTCGATGGATTTTAGTGCAACTGCTACGTCGACCACTACTACTGCACCTCAAGGCACAGATACAACAGTACCAGTAACCAACTCGACCGATGACCTTGGTTTCAGTCAGCCACCTAAAATACGACTCCTAAAATGTGGGCGTTCTCCAGTGTTTTCATATTTATACAGATCTGACCTTGATGAGGAACTTCAGCGAGAGCTTGAATTTGTGAAGAAATACGAGCTCTCTAAAACTGAGGAGAAAGACAGAATATTAGCCCTGACCATAAACGATAAACAATATGAAGAAGAAGGGCAAAAGATTGAGTGTGGCTGTTGCTATGGAGATGTGGCTTTTGAAGATATGGTTCAATGTTTGGAGGGTCATCTATTTTGTGCAAGTTGTCTGATGAACTATGCTAAGGAGGCTGCCTTTGGTCAAGGCAAAGCAACTCTCGTCTGCATGAGCGATGGATGCGATGGCACATTTCCGATGAGTCAGCTTAGGAAAGCCTTACCCACCAACATCCTGGAAAAATATGAAGATCGTGTACAAGAAGAATCATTGTTGCTGGCACAGATGGATGATTTTGTGCGATGCCCTTCTTGTGATTTTGCTGCAATTCTGCCGCCTGAAGATAAAGTTTTCAAGTGTCAGAATCCCTCTTGTGCCAAAGAAACTTGTCGCTATTGTAAAGAGGAATGGTCGGATCATTTTGGCTTAAAATGCAAAGAGGTTGAAAAGACAGCACAGAAGGATGTCAGGCTCTCGTATGAAGAAAGGATGACCATGGCAAAAATACGAAAATGCCCAAAGTGCGGATGTGAGTTTACAAAATCAGATGGCTGCAACAAAATGACATGTCGCTGTGGAGCAAAAATGTGTTATGTCTGCCGCAAGCCAAATATTGGATACAATCACTTCTGTCAGCACCCAAAGGATCCAGGAAAATCATGTACCACATGTAAAAGCTGTTCTCTGTGGACTGATCCTTCAGAAGATGACAACCGTGCAGTCAAGGAATTAGAGAAGGAGGCCCTTGAGGCAAAGAGGAAGCTTGAGGCAGAAACGGGAGAATCAGAGGGAAACCCCGCAAAAAAGGTGAAGACAGGCTGA

Transcript

OS493_007378-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9NWF9	E3 ubiquitin-protein ligase RNF216 OS=Homo sapiens OX=9606 GN=RNF216 PE=1 SV=3
P58283	E3 ubiquitin-protein ligase RNF216 OS=Mus musculus OX=10090 GN=Rnf216 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007151 (this species only)
Ubiquitin family	E3\|E3 activity\|RBR · all ubiquitin genes in this species

Pfam domain

No Pfam domain signature was detected for OS493_007378-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR051628 all species →	Family	Linear Ubiquitination-Associated E3 Ligases	Interproscan
IPR047544 all species →	Domain	E3 ubiquitin-protein ligase RNF216, RING finger, HC subclass	Interproscan
IPR044066 all species →	Domain	TRIAD supradomain	Interproscan
IPR002867 all species →	Domain	IBR domain	Interproscan
IPR047545 all species →	Domain	E3 ubiquitin-protein ligase RNF216, BRcat domain	Interproscan
IPR047546 all species →	Domain	E3 ubiquitin-protein ligase RNF216, Rcat domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22770 all species →	UBIQUITIN CONJUGATING ENZYME 7 INTERACTING PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000151 all species →	Cellular Component	ubiquitin ligase complex	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0043130 all species →	Molecular Function	ubiquitin binding	Interproscan
GO:0043161 all species →	Biological Process	proteasome-mediated ubiquitin-dependent protein catabolic process	Interproscan
GO:0071797 all species →	Cellular Component	LUBAC complex	Interproscan
GO:0097039 all species →	Biological Process	protein linear polyubiquitination	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11976	RNF216, TRIAD3; E3 ubiquitin-protein ligase RNF216	EC:2.3.2.31	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_007378-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

25.2Max TPM

1.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1.28	2.52
polyp at pH7 6	18	18	1.35	2.30
coral polyp · control treatment	16	16	2.91	25.19
coral polyp · oil and dispersant treatment	16	16	1.69	12.53
coral polyp · oil treatment	16	15	1.41	3.16
coral polyp · dispersant treatment	16	14	0.83	1.88
Polyp	10	9	0.59	1.10

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.52
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.41
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.09
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.77
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.75
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.65
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.26
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.16
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.00
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.99
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.81
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.78
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.75
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.61
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.60
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.39
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.24
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.03
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.69
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.68
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.55
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.45
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.44
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.39
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.34
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.22
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.78
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.67
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.66
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.57
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.19
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.73
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.28
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.93
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.64
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.62
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.44
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.37
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.18
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.98
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.85
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.83
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.60
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.30
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.53
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.47
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.42
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.08
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.02
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.91
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.70
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.63
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.60
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.53
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.50
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.42
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.38
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.07
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.16
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.64
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.44
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.14
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.61
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.53
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.42
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.15
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.13
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.10
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.77
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.69
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.42
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.27
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.19
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.07
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.63
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.59
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.59
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.09
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.07
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.60
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.59
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.55
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.39
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.37
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.11
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.