Gene detail

Detailed information of OS493_007612-T1 in Lophelia pertusa

Genomic Location: scaffold_17:215445...243625
NR annotation: KAJ7364978.1, hypothetical protein OS493_007612 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_007612-T1

ATGGAAGCAAGCCTTCAAAAGGAACTTAAGCAACTTAATAGACAGAGAATTAAAGCTCAGGAAAAAGGAGATTTAGCAGAAGAGGCCAAGCTCTGCAATGCTGTTGGAGAGTTGCTTTTCCAATATGGATACTATGAGAAGGCTGTTAAAGAACACAACAGAGAAGTGCAATTATCTGAAGCATGTCAAGACACCATTGAATCTGCCATTGCTCATAGGAAAGTCGGAGAATGTCTGTGTGAGCTGAAAAAGTACAAAGAAGCACTATTTCACCAAAATTTGCATCTTGAGCTTGCTCAATCAGCTGGGAACCGTGTTGAGGAACAGAGGGCCTTAGCTACCATTGGACGCACATGGTTTGTCCACTCAGAAGACTCCGCCAACAGAAGTGTTGACGAAGTCGAGGAATGCCTTGTTGAGTCACAGACAGCTTACCTGAAGAGTCTAGCTGTCTGTGACAAACTGCGGGAAACTGTTTCAGAGAAGGAATTGTTGGAGATGAGGTCAAGGTTGTATTTGAACCTTGGTCTTATTTATGAAAACCAGAAGGATTCTTCCAGGGCCAAAAGTTTTATGGAAAAGGCATTGATGATTGCTAGAGGTCAAGGGTTGAAGGACACTGAGTACCGTTGTCTATTCTCAATTGGGAGTGTGCGTATGAATTCTGACGAAGATGCACATGCTTTGAGGTGCTTTGAACAGGCCTTACAGGTGGCTAGACAGGGAAACAAGAAGTTTGATGAGGCAGATGCTTTAGCTATGTTGGGAAAGGTTTTCCTCAAACTGGGAGAATTTGCAGCTGGTCGTAGCAATTTAAAGAAAGCATACATTATCAATAAGACTAAAAGATCCGATGATATGGAGGAACTTAAATCAAGTTTAGCAACAGCTATTAAAGGAATTAGGTTTAAGAGAAAATGGGCAAAACTCTCAGAACATTCTTTGGATGAACAAATTAAAATATTGGATACCCTTGGTGACCTGTATTGTAAGGTGAAGGCTTTCCAAAACGCTCTTGGCTGCTACAAGAAAGAGCTTGAACTTGCCAAACTTGCAGGCAAATCTCACAAGGATCTGTCACCCATCTACGTGTCACTAGCAATAACATACTTTGATCTTAAATGTCCGGCTGATGCCATCAACTGCTACATGGAAGAACTGGAAATAATGGAGGAAGGCAATTACAAAGAGATGTGCGACACATGGTGTAACATTGCTTATGTACATGAAAAAGCAGGACACGACTATGAAGAAATCAAAGATGCTTACATCGAGGCTTTGGCCTGTGCAGAGCAATCTGGAAAGCATCAAGCTGTGCTGAGGGTTTGGAAGTGCCTGGCAGACACTCAACAGTTATTCGATCTGACAGACAAGCACAAAAAGTCGCTTGATAAAGTTGCAGAGCTTCAGAGTCAGTTTGGAATCGAGGATGTTGGTGATGACAGTGAAGAGGAAGGAAGGAATAGCCATGAGGATGAACTTGAAGAAGCTTTGATAGAAAAAGAATTGCTGCTTTCAGATTCTGACAATGATGACGACGACAATGAAGGAGAAGATCCTAGAGCAAGGAATAATTCAAAACCAACAAGGACAAGAAGTCAGCGAAAACATGTCAATGAGAAAGGCGAGACACCACTGCATGAGGCTGCAATTGCTGGAAATTCACAGCATGTTAAAGAGTTATTAGAGAAGGGAGCAGATGTTAATGCAAGAGATTACTGTGGCTGGCTTTCCATTCATGAGGCTTGCAACCATGGTCACTTAGATGTGGCCAAGCTTTTGCTGATGGCAGGGTCACAGGTGAATGATCAGAGTGGTCAACACTGCTGTGGTGTCACGCCACTTCATGATGCAGCAGAAAATGGCCATGTTGACATAGTTAAGCTCTTGCTGTCAAATGGAGCATCTGTCAATCTCAAGGATAACAAAGGACGTACAGCCTTGGATGCCACAATCCAAACACTCAAAATTGATAAGGTTGATGATGGGTTATCAACCGGAAGAAAGCAGGTTGTAAGATTCCTTCGGAATTACAAAGAGACCGAGAGTGGTGTAGAATTACGGAGAAGAAATGTTGTCTTTCACGAAGATAGCGAGGAAGTACAAGTAGAGTCTTCTGTAGAAAGTACACCAAGTACTTTACAGAGATTCAATGATAAATTAAAGAAGAAAGAAATGGAGAGACTACAAAGAATGAACAAGACTGTCTGTGAAGAGAGTAGTCAAGAAGACATGGATGAATTACATTCACCAACGAAAATCAACAAAGGAGCAATCATGAGTGAAGATGATGATTCACAAGAGAACCAGTGTGAAGCCATCTTATCTTATCCTTCTAGCTCATCTACAGAGTTACAAACTACTTCTAGCAGTCAAATTAATAACCTGCCAAAAAGGTCACAAATAGTTAGTAGTGTTGATGACATGGTTCCTTGTGATGCCACCATTCCAACATTTTCTGACGACAGTGACTATGAAGAAAATGATGTTGGGGATGAGGATAGCACTTACGCATCTATGGATGAGGTTGAAATGGTTGATTTGGATGATCAAAGCTCTGTTGTTGCATCAACTGCTTTTATTGATCCTGTGTCAGGAATGAGAAGTAGTAGTCACTCAAGCACTGGTCAGGTGCCATCTCTAGTCTCTCAAAAATCTGCAGATTGGCTTGTTGATGACGTTGGGTCAAGAACTGCGAAACGTAAACGTCCAGCAAAGCAAACAAAACTTACAGGATCAATTGAACAGACAAAAAGAACTTCAACAACGGCTAGACCTAAACATCGGTCAAGTCTTAGCACATCACAAAAGGTGCCTCGCCCAAAGCAATCAAGATTAGCTGTATCCAAAGAATGTAGAACACCTCAGAATGCAATCCGTGTCCCTGGCTCTTCTGTTAGTAATGTTTCAACTCCAGGACCGTCTAGACCAAGTACCATTTCTGCTGTTCCTGGGGCAAATGCTAGAATAAGTACCCCGAGCAACATTGTGGCACCTGCAGGCCCTCCACCCATGCGTCTTCGGGTACGGGTGCAGGACAAGCTGTTCATGATTCCATGTCCTCACGGCAATACACAAGAAGCTAAGAATATTGGTTGGCTGGCTGAACAGGCCTCTCTTAGGTACTTTTCCTCTTTTGGCCTTCGTCCTGTGCTAGCCTTGAAAACAAGGGAAGGTGCATTCTTGTCAGTGGAGGATAAGATTGCTGATGTGTTATCAAGTAATGAAGAAGTCACAGCATCTGTGGAATCTTGGGATTTACCTGCTTTGTCTGAAAGATATTGCGACGCATGCATCAACACCAACACAACAACAAGAACAGACATATTACACATTCTTGAAGCTGATCCTCAACTATCAAGCCTCAGTTTATCAAACAAAGCATTGCAAGATGTCCATGTACTGCCACTGTACAGAGCTCTTCAATGTCATGACACCCTTACAAAGCTTATGTTACCTGGTAACAGGATAGGTGACTCTGGTGTCCAGCATCTGGTATCAGCACTCCCAACTCTCCCCTCCCTTGCTATATTGGACTTGACGTCTAATGGAATAACTCACAAGGGGCTATCTTTTGTAGCAAATGCCTTAAGTTCCAGGGATTTTACAAGCTCAGGGACACAACAGGACCATACTCTGCAGAAACTGGAAGAATTAAGCATCAGCTACAACTGGTTGGGTGACAGTGTTGGTGGCTCATTGGCTGTTATTCTTAACAGATGTCCTATTCTGAACACTTTAAGAATAGAATCTTGTGGCCTGACAAGTCAAGTCACTGCCCAAGGAAAAGAATTCCCTGTAGCTCTAAAAGGATCTAGATTATTACAGCTGTCTGTGGCCTACAATTCCCTTGGTTTTCAGGGAATAACAAATTTGATAACAGCTCTTCCTTCTGGATCACTGCGTCACCTCAACATAACCTCGTCATTGGAAGATAAAGGAAGTCAGTCAGTTATTCAGAGTCTGGTGGAACTCATGGAAAGAGGCTGTGCTCTTTCTGATCTGGTTCTTGGAGATTGTTACATTGGCGACAAAGATGTAGAGCTCCTCATCCAAGCCAAGCATATGTTCTCTGAACTACAATATCTGGATCTGAGTTGTAATAAAATTGGAAACGATGGATTACCATCGCTTGCAAGACTACTCAAAGAAAGCTGCAAACTTACGAGTCTCACACTAGCTGGCAATGGAAGCATCAGCGCTGTCGGCGCAGGGTCTCTGCTTATGGCAGCTAAGGACAGTAAAACCCTTCAAAAACTCAACTTATCAGCATGTGGAGTCAAATCGCCTCTTGATGAGACATTCTTTGATGCTTTGAAAAATGCAGTTTCTCAAAATGATGGGGAAAGTACTTTTACAGAACTGGATCTTTCTCACAATATGATAAGTGTTGTTGAGAGAGACTGTCTAGCACAAGAATGGAATCTGAAATGTACCGGGGAGAGTGTATCTTGTCTGAATAACAATCTATGTGTGTTGACAAAATTGTGA

Transcript

OS493_007612-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q0P5G1	Tonsoku-like protein OS=Bos taurus OX=9913 GN=TONSL PE=2 SV=1
A9JR78	Tonsoku-like protein OS=Danio rerio OX=7955 GN=tonsl PE=2 SV=1
D4A615	Tonsoku-like protein OS=Rattus norvegicus OX=10116 GN=Tonsl PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004146 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF13516 all species →	LRR_6	Leucine Rich repeat	Repeat	Interproscan
PF13181 all species →	TPR_8	Tetratricopeptide repeat	Repeat	Interproscan
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR052311 all species →	Family	MMS22L-TONSL complex component	Interproscan
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46358 all species →	TONSOKU-LIKE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0031297 all species →	Biological Process	replication fork processing	Interproscan
GO:0043596 all species →	Cellular Component	nuclear replication fork	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09257	NFKBIL2; NF-kappa-B inhibitor-like protein 2	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_007612-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

35.9Max TPM

4.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.25	9.37
polyp at pH7 6	18	18	4.61	7.48
coral polyp · control treatment	16	16	6.66	35.88
coral polyp · oil and dispersant treatment	16	16	5.10	35.74
coral polyp · oil treatment	16	16	4.64	8.47
coral polyp · dispersant treatment	16	16	4.06	8.21
Polyp	10	10	3.88	6.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.37
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.29
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.37
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.06
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.02
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.85
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.47
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.17
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.92
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.91
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.89
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.87
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.79
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.54
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.25
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.26
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.12
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.48
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.44
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.59
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.58
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.36
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.26
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.08
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.04
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.72
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.06
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.97
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.39
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.94
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.90
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.84
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.04
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.88
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.24
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.87
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.30
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.55
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.36
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.26
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.81
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.52
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.85
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.10
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.74
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.44
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.01
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.54
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.13
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.10
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.97
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.86
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.81
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.50
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.23
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.77
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.66
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.20
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.47
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.02
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.56
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.48
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.76
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.01
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.74
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.20
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.04
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.96
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.91
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.88
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.21
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.28
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.49
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.96
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.91
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.64
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.33
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.07
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.71
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.54
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.22
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.74
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.60
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.22
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.89
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.78
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.55
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.55
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.47
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.99
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.37
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.25

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.