Gene detail

Detailed information of OS493_007966-T1 in Lophelia pertusa

Genomic Location: scaffold_18:2026363...2048338
NR annotation: KAJ7337809.1, hypothetical protein OS493_007966 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_007966-T1

ATGAGTTTTCCATGTGTTCTTGGCATGAACGAAGTTGGATGGGAAGATGGAGCGTACCACAACAATGGTATGACTCCAAAACTCGTAGGACGCACCAGTAATGGTGGATCGAAGACGAACAACGGTGGCTTCGAAATTGTAGGTGGCAAATCGAACGGGGAAGTCGCGAGTTACCTCTTCCAGCGTCAAGGAGTCGCTACTAGCTTTTCAAAAACAGTTGCAGAAAACGACAAAGGCAATTTTTCCGGCCAGCGATGGTCATCTGTTGGTGAAGGAATGTCGGAACAGACAAATTCCAAGGATGGAGAATTGGATGACAAATTCCAGAGCTTGTCTTTGAACAACAATGAAAAGAAAGCTGATACACCAATAGAGGAGATTGCTTCTACTGCAAAGAAACTGTGGGATGTTCAAGACTCTGGTGAGGAGGTAGGCATGACATCTGGTATTTTCTTTGGTGAACAGTGGAGGGAGACGGCATGGGGCCCATCAGTACCTCACATGGCACAGTCAGAGCATGCTGTATCGCAGCCAATCATGGTGCAGCGTCCCGCCAAGGGAGGAAATTTCAATAATGCTTCCGAGTCGCAGAGTGTACTGTCACCCAGATCAGCTGACGGAGTGGGACTCAGCATGGTGGAATATGTCTTGGCTTCATCACCTGGTGGGCAAGAGCTAGATGCGCAAATAATTAAAGCTGGATTTGGTACCTCTCCATCTTCTGATGTTTTGTCTGACAAGGGACCTAAACCTAATGGTGAAAGCAAAGGAAGTAAGGGTGGCTCGCCCTTTGAAGAAGGGACTGGGGAGGAACTAAAGCATGTGCTTCAGGACGAACAAGGACATGAATCTCCTAAGCCCACCCCTAAGCAAAGTGGAGAGGAAGCAACTGGAACCTTTAGCCGCACTCCTGGCAGTAGACAACCCTCTCCCACTTCAGTCTCTCAACAGCAAGATGCTCAACAGACCACCCAACCACAGCTACAGTCACAACCACCAGTGGGTCAGAACAAGACCAAGCCTTATAAACAGTCTGATCCTATTGAAGACATTGTCACGCATGTGGCCTTGATTGATCCTCTTGAAAGTGTACAACTAGAGCAGCTGTCATTTGCACCACACAGAGAGCCATTGATTGGCACTCCTACAAGCCCTTCAGACTTTGTAATGGTCTCTGGGGCATCCCTACAAAGCCATAATGCTGTTACTTCTCAGCATGGTCAATCACTTCACTTAACACACCAGCATCAGTTGGCACTGGCAATGGCTGCTCAACAACAACAACAACAACAACAACAACAACAGCAACAACAACAACAACAGCAGCAGCAGCAGCAGCAATTAGGATTACAGTCTAGCTTGCAATCCACTGGAATTGGCCATCCAAACTCTTATTATATTACAGCGCAGCCTACACAAGATCCGTATGGTAATCCATCACTTGCTGCAGTCAGTGGTGGTGCCCCTCAAGTTGTCCATCCTCAGTATGCAGCATACAGTGTTCAACCCTGGGGTATGTATTCTGCGGCTGGAGCATCCAACACAGCAGGGTACCTCCAGCAACAGCAGCAACAACAACAGCAGCAGGCTCAGCATGCTCAGTTACTTCGCTCCAACTCGGGTGGGATGACTGGACGACCCATGCAGGGACAGATGGAGATCATTGGGACACCACCATCACACCAGCAGCAGGCCATGGCTGCAGCTGCTTCTTCTGGCACTAACTACCAGCTAATTGCTCCACCTGGTGCAGCCCCATTAGGGTTAGGAGCCACTGCATATTATGATCAGTCAGGGAACTTGGTGCTAGGGAATGCACAGAGTGTCAACAATATGGCTACAGCACAAATGGCTGCTGGTCAAATGGGAGCCCTCAGAATGGTGTCTCCAGTGGTAGTTAACGCCCAGAATGCAGGTGCCAGCTCTGTTGCAGCAGGACGAATGGGAACCGCCAGCTCAATGGGTGGGGCATCCAGCATGGGGCTGTTTGGACAACAAACACAACAACAGCAGCAGCTAAACAGCAGTGCGCTGGGAATGCTTGGAAGTGTTGTGGGAGGCTCTTCTGGAGTTGGTGCTGTAGGAACCATTCCTGGAGGAGGAACAAGGAGAGATTCAATGAATGCCACAGAATATGGCAAACGAGCTGGAATTGCCCAGTACTATGCAACACAAGGTGCTGTAAGCAGTCTTGCCAGTTTGTCAATCTCAGCACAGCCTTCTTACAATGCCCCTCAGGAGCTACCAACCCCTCCTCTTCTTTCACAGGGACAGTCTGGTTTTGGTGGCCAGTCAGGTTATGGGGGACAGTCAGGCTTCACTGTTGGTAGCCCCATCTCTAATGGCCTCTCGCGCTACATGCAACTTGCTGCTGCTCCAAGGGAATCCCATACAAAGTATCAAGGATCACTTGGAAGCCTTAGTGGGATGCAGTTTGGCACTTCTACTTTAGGGGGAAGCAGCTTCCGAGGATCCAGAGGTAAAGAAACTGGGAGGAGTAGGCTTTTAGAAGACTTCCGCAATAATCGCTACCCAAACATCCAGCTACGGGACTTGGCAAATCACATTGTGGAATTTTCACAGGACCAGCATGGTTCAAGGTTCATTCAACAGAAATTGGAGCGTGCTTCTCCCAATGAAAAGCAGATGGTTTTCCATGAAATACTTCCAGCTGCATACAGTTTGATGACTGATGTGTTTGGAAACTATGTCATACAGAAGTTCTTTGAGTTTGGGAGTCCTGAACAGAAGCATCACCTTGCCAACTGCATCCGTGGACATGTGTTGCCTCTTGCCTTACAAATGTATGGATGTCGTGTAATACAGAAAGCTTTGGAGTGTATTTCCCCTGATGTTCAGAATGATCTGGTAAGAGAATTGGACGGACATGTGTTGAAGTGTGTCAAGGATCAGAATGGGAACCATGTGGTACAGAAGTGTATTGAGTGTGTTGACCCATCCTCTCTCCAGTTTATCATTGGAGCTTTTCAAGCTCAGGTGTATGCCCTGTCAACTCATCCCTATGGATGCCGTGTGATCCAACGTATCCTTGAGCACTGCATGCCAGAGCAGACATGTCCAATACTGGATGAATTACATCAGCATACCGAAAGACTTGTTCAAGATCAATATGGCAACTATGTGATCCAACATGTCTTAGAACATGGTACACTTGAAGACAAGAGCAAGATTGTCCATGAACTCCGAGGCAACATACTAATTTTTAGCCAGCACAAATTTGCAAGCAATGTGGTTGAAAAGTGTGTGACTCATGCATCTCGTGCAGAAAGAGCCATGCTCATTGATGAAGTTTGCAGTAGCAGTGATAGTGCCTTATACACCATGATGAAAGATCAGTTTGCAAATTATGTCGTCCAGAAGATGATTGATGTCTCGGAACCTCCCCAACGCAAACTGCTGATGCACAGGATTCGACCCCATGTAGCAACATTGCGCAAGTACACATATGGAAAGCACATTCTAGCCAAGTTAGAGAAATATTACATGACCATGAAACCTACACCTGATTTTCTCCCTTTGACCAATGGTCCACTGCTTTAG

Transcript

OS493_007966-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q80U58	Pumilio homolog 2 OS=Mus musculus OX=10090 GN=Pum2 PE=1 SV=2
Q8TB72	Pumilio homolog 2 OS=Homo sapiens OX=9606 GN=PUM2 PE=1 SV=2
Q66KI6	Pumilio homolog 1 OS=Xenopus laevis OX=8355 GN=pum1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003727 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00806 all species →	PUF	Pumilio-family RNA binding repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001313 all species →	Repeat	Pumilio RNA-binding repeat	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR033133 all species →	Domain	Pumilio homology domain	Interproscan
IPR033712 all species →	Domain	Pumilio, RNA binding domain	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12537 all species →	RNA BINDING PROTEIN PUMILIO-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0003730 all species →	Molecular Function	mRNA 3'-UTR binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0010608 all species →	Biological Process	post-transcriptional regulation of gene expression	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17943	PUM; pumilio RNA-binding family	-	Spinocerebellar ataxia	ko05017	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_007966-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

117.9Max TPM

57.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	48.61	84.41
polyp at pH7 6	18	18	49.23	80.80
coral polyp · control treatment	16	16	66.83	109.50
coral polyp · oil and dispersant treatment	16	16	84.09	117.89
coral polyp · oil treatment	16	16	55.54	92.53
coral polyp · dispersant treatment	16	16	65.79	105.59
Polyp	10	10	24.54	43.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	84.41
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.57
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.21
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.72
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.42
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.09
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.96
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.66
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.40
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.33
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.02
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.32
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.90
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.61
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.49
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.64
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.63
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	80.80
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	80.26
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	80.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	79.68
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.31
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.69
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.54
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.08
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.42
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.92
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.82
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.96
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.02
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.23
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.47
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	109.50
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.14
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	93.41
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.51
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	87.64
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	77.27
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.15
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.53
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.52
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.49
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.87
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.71
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.68
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.15
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	117.89
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	117.82
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	110.35
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	110.28
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	108.40
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	102.27
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	95.79
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	90.64
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.71
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.28
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.56
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.53
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.23
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.74
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.74
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.16
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	92.53
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	90.54
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	79.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	73.19
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.89
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.60
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.29
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.32
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.83
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.34
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.10
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.46
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.24
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.13
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.43
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	105.59
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	101.97
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	91.34
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	91.09
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	82.79
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	79.39
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.89
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.06
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.00
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.68
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.18
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.23
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.34
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.74
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.58
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.80
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	43.91
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	38.44
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	34.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	25.98
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	23.49
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	18.67
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	17.82
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	16.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.35
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	12.85

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.