Gene detail

Detailed information of OS493_008126-T1 in Lophelia pertusa

Genomic Location: scaffold_18:3938976...3955802
NR annotation: KAJ7337959.1, Protein PAT1 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008126-T1

ATGGCGGACACTTTCTTTGGTTTCAACCCAGAGATTCCGGCCTTTGAGGATGAAGACTTGTCCCAATTGGACCCATCGCTGACGAATCTCACAGAAGGAGATAACTATGACCAGCTAAATGACGATACATTTGGCGCTGGAGCTTTAGAGGATGATTGGGAACTTGCGCACAGAAAACAAGCCGGTATAAACAATGAAGACCCACAAAGGACTCAGTTTGATGATTGGCTCAGGAAAAAGGGGCTTGGATCAGAGCAAGATGATCCTAAATCAAAATCATCACAAGCTAAGGAAATTACCAATGATGAGGATTCTGAGAATGAGCTGGATCGAGAAGAGGAAATTCTTGAACAGAACTTGACCAAACTGGTTGATGATGATGAAGGTGAATCTATACCCATCCCCAAAGCATCATCCAAATACAAGGACATCAAGCATCCATCAGGTATTAACCCAGTGTGGGATGGTACATCACCTCTCTCCAGTCCAACTTCATCTACATCATTACATGATCTGATATCACCATCCTCCAGTATATGGGGATCACCGTCCAAACTTGATAAAGAAAACACTAACAAAGGACCAGTCAATACTCAGCCATCACCAGTGCTGACAGAGCTGCTGAAGTCAGAGGGGGAAAAGAAACGCACACAAAGGAGACCTTTCTCACCAGCCTTTGAGGATGACTCCATTGTACAAGCTGTGCCACGTCAAGGCCTGGTCCCACCAAGTCGTTTCATGAAGAAGCCTCAGCCTGTTAATGCAATTAAGCTGGAGGACCTTGAGAAGGAACTTACTGGCACTGACAGTGCTCTGCAGCAAGTGCCTGAGGGGCCTGCAATGCACACACCTCGTAAGTTGATGATTGGACAACCACCTCCTGGTATTCCAAGACCTATGATGACACCTCCAGGCTATCATTTCTCCTGCTGCGAGGATGCATACTCCACCAGTGCCTCCCAGATGTTTCAACACAGACCCAGTCCATCCAAGCACCCCATGCCAAGCCATGCCTGGTATGCCTGGAATGCCTGGTATGCCTGGAATGCATGGAATGCCTGGTATGCCAGGCTCGGGACCTCACATGATGAGAACGCCAAGGACACCACCTTTTCCAAGACATCCATTTCCCATGGTACACTCAGATCCTGGTCACATGATGTTACGGGGAGGCATGATGAAACTTTCCAATGGGTCCACAGCACCCAAGGTTTGCCAGCCCCCAGCTTCATAACAGAAGATTTCAGACCCACGACAGAATTATCCAAGACACCAAGTGGCCCAAGAAGAGATGATCCTTATGCTGGTCTCATGACAAGAAGAGAGAAGGAATGGTTGATTAAGATTCAGCTCCTTCAACTCACTAGCAATGAACCTGAACTTGATGATTATTACTTTCAAACTTACACCAGGAGAAAGGCTGCTAAGGAACGGGCAAAGCAAACTGAGGGTGTACAACACAATGTTCAAGATAACAAGACAGGTAGAGAAACAACAAAGATGGCCTTGCCACAGTTTGAGCGAGAGAAAAAGAACTACACTCCATGGGACTTCCAAGGTACTTTAGGGAAGGTATCATCATCATCCGTGCAGCACCCAAGGCAAATGGTAGATTTAATGCACATAAGTAAAGGATCTGAACAGGAAAAACAAGGTAGTTCAACTCCTATGAAGGACACAAAGCGACGCAGCCAGCTACTTTTTACTATAGAAAAGAGCTATGACTGTCTTTTGAATATTGAAAGTTTAGAGAAAAAGTTAATTCATGTTGAAGGACAAGAAAGGAATGAACTCTTTGAAACCAGACAGCTCACCGTGACAAAGCTGTTCAACCTCTTGAAACTTTCCATTGAAGATTCTACAAAGTGCGATGATGACTTCTTTGTACAATTTCTATCAGTCCATAAAGGGAAACTTCTTCTCAGTAGGGCTCTTCCCATGTTTAACACGGTTCAAATAGAAGCAGTATTAATGGCAATTACCAGGAATATTTCATCACTCATTAGAAAAGACATCAATGAAGAGAGCTTGCATAATTTAATGGTTCCTCTTAATCGAGTGTCGGAACTGGTGTCTCCATCAGTAGTGATCCGGTGTCTTCAAGACATGGTGTCTGCACCAAGTATCTCCACCACTCAAGGATCACCTCTCGGTGTAGTTCTACTTAATCAGTTTGGTGTAGGAATTCTGAGCATACTACTAGGAAGAGCAGCTGTCATATCTGACAGTTTAACTGAATCAGATGAAGACATGCGGAAATCTTGGTCAAACATTGTGTCTCAAGTAGCGAGTGAGTTCCAAGATGTACCTGTGAAACAGCTGGGAAGGAACCTTGAAGCAGCCGACAGATTAGTAGCTTTGTTGTCCACTTGTACTGATCTCCAAACCAAAGCATTACTACAGGAACACTTAAGGCTCGCTGCTTCTGCGAAATGA

Transcript

OS493_008126-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2RRV3	Protein PAT1 homolog 1 OS=Danio rerio OX=7955 GN=patl1 PE=1 SV=1
B5DF93	Protein PAT1 homolog 1 OS=Rattus norvegicus OX=10116 GN=Patl1 PE=2 SV=1
Q3TC46	Protein PAT1 homolog 1 OS=Mus musculus OX=10090 GN=Patl1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004039 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF09770 all species →	PAT1	Topoisomerase II-associated protein PAT1	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019167 all species →	Domain	mRNA decay factor PAT1 domain	Interproscan
IPR039900 all species →	Family	Pat1-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21551 all species →	TOPOISOMERASE II-ASSOCIATED PROTEIN PAT1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000290 all species →	Biological Process	deadenylation-dependent decapping of nuclear-transcribed mRNA	Interproscan
GO:0000932 all species →	Cellular Component	P-body	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0033962 all species →	Biological Process	P-body assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12617	PATL1, PAT1; DNA topoisomerase 2-associated protein PAT1	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008126-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

57.5Max TPM

15.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.69	23.89
polyp at pH7 6	18	18	13.44	20.67
coral polyp · control treatment	16	16	21.26	57.54
coral polyp · oil and dispersant treatment	16	16	18.93	40.96
coral polyp · oil treatment	16	16	17.64	25.75
coral polyp · dispersant treatment	16	16	12.33	25.19
Polyp	10	10	9.75	19.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.89
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.98
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.50
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.24
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.85
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.40
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.54
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.22
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.53
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.52
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.53
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.36
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.56
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.50
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.57
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.67
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.70
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.75
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.97
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.73
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.16
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.55
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.85
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.73
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.32
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.91
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.89
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.95
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.87
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.62
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.01
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.54
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.86
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.50
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.22
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.20
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.49
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.44
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.92
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.34
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.74
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.82
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.43
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.72
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.65
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.63
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.96
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.75
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.41
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.17
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.96
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.89
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.19
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.92
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.03
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.32
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.90
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.93
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.52
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.24
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.75
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.23
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.01
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.66
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.35
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.22
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.73
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.72
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.14
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.61
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.71
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.63
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.30
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.50
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.60
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.19
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.00
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.61
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.35
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.14
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.07
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.62
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.87
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.12
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.11
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.34
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.23
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.61
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.81
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	19.48
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.43
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.50
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.48
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.15
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.29
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.91
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.65

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.